ID: 1177743292

View in Genome Browser
Species Human (GRCh38)
Location 21:25179592-25179614
Sequence CAATTTAGCATCAGAAAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177743289_1177743292 11 Left 1177743289 21:25179558-25179580 CCTTTCAACTTTTACTTATAAGT No data
Right 1177743292 21:25179592-25179614 CAATTTAGCATCAGAAAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177743292 Original CRISPR CAATTTAGCATCAGAAAGCA GGG Intergenic
No off target data available for this crispr