ID: 1177744949

View in Genome Browser
Species Human (GRCh38)
Location 21:25200772-25200794
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177744949_1177744959 24 Left 1177744949 21:25200772-25200794 CCTTCAACCTTCTACTTGGCCAT No data
Right 1177744959 21:25200819-25200841 AGTCGTGATAAAGCTCATCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177744949 Original CRISPR ATGGCCAAGTAGAAGGTTGA AGG (reversed) Intergenic
No off target data available for this crispr