ID: 1177748842

View in Genome Browser
Species Human (GRCh38)
Location 21:25255017-25255039
Sequence GCTGTTCAACATTCAGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177748838_1177748842 15 Left 1177748838 21:25254979-25255001 CCAAATACCTTAGAAAATTTGAC No data
Right 1177748842 21:25255017-25255039 GCTGTTCAACATTCAGTGTATGG No data
1177748839_1177748842 8 Left 1177748839 21:25254986-25255008 CCTTAGAAAATTTGACAAGATAA No data
Right 1177748842 21:25255017-25255039 GCTGTTCAACATTCAGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177748842 Original CRISPR GCTGTTCAACATTCAGTGTA TGG Intergenic
No off target data available for this crispr