ID: 1177751081

View in Genome Browser
Species Human (GRCh38)
Location 21:25284653-25284675
Sequence CCAGATTGAAAACCTAACTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177751078_1177751081 14 Left 1177751078 21:25284616-25284638 CCTTGTGGACGAATCATAATGTA No data
Right 1177751081 21:25284653-25284675 CCAGATTGAAAACCTAACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177751081 Original CRISPR CCAGATTGAAAACCTAACTT AGG Intergenic
No off target data available for this crispr