ID: 1177755172

View in Genome Browser
Species Human (GRCh38)
Location 21:25337800-25337822
Sequence ATAGATAAGAAGACTGGAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177755169_1177755172 11 Left 1177755169 21:25337766-25337788 CCTGGTATTTATATCAAGTGTAA No data
Right 1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG No data
1177755168_1177755172 27 Left 1177755168 21:25337750-25337772 CCACAGTTTTATTTAACCTGGTA No data
Right 1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177755172 Original CRISPR ATAGATAAGAAGACTGGAGA AGG Intergenic
No off target data available for this crispr