ID: 1177760154

View in Genome Browser
Species Human (GRCh38)
Location 21:25394123-25394145
Sequence GGATTATGCAGAAGCCACTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177760152_1177760154 3 Left 1177760152 21:25394097-25394119 CCTATGAAGGGAAGGGAGGGGAA No data
Right 1177760154 21:25394123-25394145 GGATTATGCAGAAGCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177760154 Original CRISPR GGATTATGCAGAAGCCACTC TGG Intergenic
No off target data available for this crispr