ID: 1177761721

View in Genome Browser
Species Human (GRCh38)
Location 21:25409160-25409182
Sequence GAGTAGAATGGTGGTTTTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177761716_1177761721 30 Left 1177761716 21:25409107-25409129 CCATATGATCTCACTCATGTGGA No data
Right 1177761721 21:25409160-25409182 GAGTAGAATGGTGGTTTTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177761721 Original CRISPR GAGTAGAATGGTGGTTTTAC AGG Intergenic
No off target data available for this crispr