ID: 1177765194

View in Genome Browser
Species Human (GRCh38)
Location 21:25449896-25449918
Sequence CACAGGGGTGGAGCTACCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2591
Summary {0: 10, 1: 228, 2: 487, 3: 783, 4: 1083}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177765194_1177765207 19 Left 1177765194 21:25449896-25449918 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1177765207 21:25449938-25449960 CCACAGCTGCTTTCACGGGCTGG No data
1177765194_1177765201 14 Left 1177765194 21:25449896-25449918 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1177765201 21:25449933-25449955 AACCCCCACAGCTGCTTTCACGG No data
1177765194_1177765202 15 Left 1177765194 21:25449896-25449918 CCTTGGGTAGCTCCACCCCTGTG 0: 10
1: 228
2: 487
3: 783
4: 1083
Right 1177765202 21:25449934-25449956 ACCCCCACAGCTGCTTTCACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177765194 Original CRISPR CACAGGGGTGGAGCTACCCA AGG (reversed) Intergenic
Too many off-targets to display for this crispr