ID: 1177766191

View in Genome Browser
Species Human (GRCh38)
Location 21:25460355-25460377
Sequence GATTTGCTAGGAGAAGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177766191_1177766200 25 Left 1177766191 21:25460355-25460377 CCATATTCTTCTCCTAGCAAATC No data
Right 1177766200 21:25460403-25460425 AAACTGGTGCTTGTTTCTGTGGG No data
1177766191_1177766199 24 Left 1177766191 21:25460355-25460377 CCATATTCTTCTCCTAGCAAATC No data
Right 1177766199 21:25460402-25460424 CAAACTGGTGCTTGTTTCTGTGG No data
1177766191_1177766194 9 Left 1177766191 21:25460355-25460377 CCATATTCTTCTCCTAGCAAATC No data
Right 1177766194 21:25460387-25460409 TGACACCCCCACACGCAAACTGG No data
1177766191_1177766201 26 Left 1177766191 21:25460355-25460377 CCATATTCTTCTCCTAGCAAATC No data
Right 1177766201 21:25460404-25460426 AACTGGTGCTTGTTTCTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177766191 Original CRISPR GATTTGCTAGGAGAAGAATA TGG (reversed) Intergenic