ID: 1177766193

View in Genome Browser
Species Human (GRCh38)
Location 21:25460367-25460389
Sequence TCACTGTCCAAAGATTTGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177766193_1177766201 14 Left 1177766193 21:25460367-25460389 CCTAGCAAATCTTTGGACAGTGA No data
Right 1177766201 21:25460404-25460426 AACTGGTGCTTGTTTCTGTGGGG No data
1177766193_1177766199 12 Left 1177766193 21:25460367-25460389 CCTAGCAAATCTTTGGACAGTGA No data
Right 1177766199 21:25460402-25460424 CAAACTGGTGCTTGTTTCTGTGG No data
1177766193_1177766194 -3 Left 1177766193 21:25460367-25460389 CCTAGCAAATCTTTGGACAGTGA No data
Right 1177766194 21:25460387-25460409 TGACACCCCCACACGCAAACTGG No data
1177766193_1177766202 19 Left 1177766193 21:25460367-25460389 CCTAGCAAATCTTTGGACAGTGA No data
Right 1177766202 21:25460409-25460431 GTGCTTGTTTCTGTGGGGAGAGG No data
1177766193_1177766200 13 Left 1177766193 21:25460367-25460389 CCTAGCAAATCTTTGGACAGTGA No data
Right 1177766200 21:25460403-25460425 AAACTGGTGCTTGTTTCTGTGGG No data
1177766193_1177766203 27 Left 1177766193 21:25460367-25460389 CCTAGCAAATCTTTGGACAGTGA No data
Right 1177766203 21:25460417-25460439 TTCTGTGGGGAGAGGAAGAAAGG No data
1177766193_1177766204 28 Left 1177766193 21:25460367-25460389 CCTAGCAAATCTTTGGACAGTGA No data
Right 1177766204 21:25460418-25460440 TCTGTGGGGAGAGGAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177766193 Original CRISPR TCACTGTCCAAAGATTTGCT AGG (reversed) Intergenic