ID: 1177766199

View in Genome Browser
Species Human (GRCh38)
Location 21:25460402-25460424
Sequence CAAACTGGTGCTTGTTTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177766193_1177766199 12 Left 1177766193 21:25460367-25460389 CCTAGCAAATCTTTGGACAGTGA No data
Right 1177766199 21:25460402-25460424 CAAACTGGTGCTTGTTTCTGTGG No data
1177766191_1177766199 24 Left 1177766191 21:25460355-25460377 CCATATTCTTCTCCTAGCAAATC No data
Right 1177766199 21:25460402-25460424 CAAACTGGTGCTTGTTTCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177766199 Original CRISPR CAAACTGGTGCTTGTTTCTG TGG Intergenic