ID: 1177766204

View in Genome Browser
Species Human (GRCh38)
Location 21:25460418-25460440
Sequence TCTGTGGGGAGAGGAAGAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177766193_1177766204 28 Left 1177766193 21:25460367-25460389 CCTAGCAAATCTTTGGACAGTGA No data
Right 1177766204 21:25460418-25460440 TCTGTGGGGAGAGGAAGAAAGGG No data
1177766195_1177766204 3 Left 1177766195 21:25460392-25460414 CCCCCACACGCAAACTGGTGCTT No data
Right 1177766204 21:25460418-25460440 TCTGTGGGGAGAGGAAGAAAGGG No data
1177766197_1177766204 1 Left 1177766197 21:25460394-25460416 CCCACACGCAAACTGGTGCTTGT No data
Right 1177766204 21:25460418-25460440 TCTGTGGGGAGAGGAAGAAAGGG No data
1177766198_1177766204 0 Left 1177766198 21:25460395-25460417 CCACACGCAAACTGGTGCTTGTT No data
Right 1177766204 21:25460418-25460440 TCTGTGGGGAGAGGAAGAAAGGG No data
1177766196_1177766204 2 Left 1177766196 21:25460393-25460415 CCCCACACGCAAACTGGTGCTTG No data
Right 1177766204 21:25460418-25460440 TCTGTGGGGAGAGGAAGAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177766204 Original CRISPR TCTGTGGGGAGAGGAAGAAA GGG Intergenic