ID: 1177767482

View in Genome Browser
Species Human (GRCh38)
Location 21:25474732-25474754
Sequence CAATTATGGCAGAGGGTGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177767482_1177767487 -2 Left 1177767482 21:25474732-25474754 CCCTTCACCCTCTGCCATAATTG No data
Right 1177767487 21:25474753-25474775 TGCAAGTTTCCTGAGCCATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177767482 Original CRISPR CAATTATGGCAGAGGGTGAA GGG (reversed) Intergenic
No off target data available for this crispr