ID: 1177770427

View in Genome Browser
Species Human (GRCh38)
Location 21:25508576-25508598
Sequence TCCGGCAAACCTAGATGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177770427_1177770431 16 Left 1177770427 21:25508576-25508598 CCACCTCATCTAGGTTTGCCGGA No data
Right 1177770431 21:25508615-25508637 GCACTGAAGTCCCACATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177770427 Original CRISPR TCCGGCAAACCTAGATGAGG TGG (reversed) Intergenic