ID: 1177770428

View in Genome Browser
Species Human (GRCh38)
Location 21:25508579-25508601
Sequence GTCTCCGGCAAACCTAGATG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177770428_1177770431 13 Left 1177770428 21:25508579-25508601 CCTCATCTAGGTTTGCCGGAGAC No data
Right 1177770431 21:25508615-25508637 GCACTGAAGTCCCACATTCCAGG No data
1177770428_1177770435 30 Left 1177770428 21:25508579-25508601 CCTCATCTAGGTTTGCCGGAGAC No data
Right 1177770435 21:25508632-25508654 TCCAGGAACCTCTCTTTCCTGGG No data
1177770428_1177770434 29 Left 1177770428 21:25508579-25508601 CCTCATCTAGGTTTGCCGGAGAC No data
Right 1177770434 21:25508631-25508653 TTCCAGGAACCTCTCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177770428 Original CRISPR GTCTCCGGCAAACCTAGATG AGG (reversed) Intergenic