ID: 1177770430

View in Genome Browser
Species Human (GRCh38)
Location 21:25508594-25508616
Sequence GCTAAGCCTGAGAAAGTCTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177770430_1177770435 15 Left 1177770430 21:25508594-25508616 CCGGAGACTTTCTCAGGCTTAGC No data
Right 1177770435 21:25508632-25508654 TCCAGGAACCTCTCTTTCCTGGG No data
1177770430_1177770438 23 Left 1177770430 21:25508594-25508616 CCGGAGACTTTCTCAGGCTTAGC No data
Right 1177770438 21:25508640-25508662 CCTCTCTTTCCTGGGAAAACTGG No data
1177770430_1177770434 14 Left 1177770430 21:25508594-25508616 CCGGAGACTTTCTCAGGCTTAGC No data
Right 1177770434 21:25508631-25508653 TTCCAGGAACCTCTCTTTCCTGG No data
1177770430_1177770431 -2 Left 1177770430 21:25508594-25508616 CCGGAGACTTTCTCAGGCTTAGC No data
Right 1177770431 21:25508615-25508637 GCACTGAAGTCCCACATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177770430 Original CRISPR GCTAAGCCTGAGAAAGTCTC CGG (reversed) Intergenic