ID: 1177770431

View in Genome Browser
Species Human (GRCh38)
Location 21:25508615-25508637
Sequence GCACTGAAGTCCCACATTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177770428_1177770431 13 Left 1177770428 21:25508579-25508601 CCTCATCTAGGTTTGCCGGAGAC No data
Right 1177770431 21:25508615-25508637 GCACTGAAGTCCCACATTCCAGG No data
1177770430_1177770431 -2 Left 1177770430 21:25508594-25508616 CCGGAGACTTTCTCAGGCTTAGC No data
Right 1177770431 21:25508615-25508637 GCACTGAAGTCCCACATTCCAGG No data
1177770427_1177770431 16 Left 1177770427 21:25508576-25508598 CCACCTCATCTAGGTTTGCCGGA No data
Right 1177770431 21:25508615-25508637 GCACTGAAGTCCCACATTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177770431 Original CRISPR GCACTGAAGTCCCACATTCC AGG Intergenic
No off target data available for this crispr