ID: 1177770493

View in Genome Browser
Species Human (GRCh38)
Location 21:25509344-25509366
Sequence ATAAGGTTCTTAAACTAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177770490_1177770493 -3 Left 1177770490 21:25509324-25509346 CCAATTACCTCAGTTACACTATA No data
Right 1177770493 21:25509344-25509366 ATAAGGTTCTTAAACTAACCTGG No data
1177770492_1177770493 -10 Left 1177770492 21:25509331-25509353 CCTCAGTTACACTATAAGGTTCT No data
Right 1177770493 21:25509344-25509366 ATAAGGTTCTTAAACTAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177770493 Original CRISPR ATAAGGTTCTTAAACTAACC TGG Intergenic
No off target data available for this crispr