ID: 1177770702

View in Genome Browser
Species Human (GRCh38)
Location 21:25512491-25512513
Sequence AAACATGTGGGGCAGTTCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177770698_1177770702 1 Left 1177770698 21:25512467-25512489 CCTGGGAGTCAGGATGTGCAGAA No data
Right 1177770702 21:25512491-25512513 AAACATGTGGGGCAGTTCACAGG No data
1177770696_1177770702 11 Left 1177770696 21:25512457-25512479 CCTGTGCAGGCCTGGGAGTCAGG No data
Right 1177770702 21:25512491-25512513 AAACATGTGGGGCAGTTCACAGG No data
1177770695_1177770702 12 Left 1177770695 21:25512456-25512478 CCCTGTGCAGGCCTGGGAGTCAG No data
Right 1177770702 21:25512491-25512513 AAACATGTGGGGCAGTTCACAGG No data
1177770694_1177770702 13 Left 1177770694 21:25512455-25512477 CCCCTGTGCAGGCCTGGGAGTCA No data
Right 1177770702 21:25512491-25512513 AAACATGTGGGGCAGTTCACAGG No data
1177770690_1177770702 26 Left 1177770690 21:25512442-25512464 CCTGTGCAGAAGTCCCCTGTGCA No data
Right 1177770702 21:25512491-25512513 AAACATGTGGGGCAGTTCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177770702 Original CRISPR AAACATGTGGGGCAGTTCAC AGG Intergenic
No off target data available for this crispr