ID: 1177773145

View in Genome Browser
Species Human (GRCh38)
Location 21:25539450-25539472
Sequence CACTGCTTGTGGAGGGCAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177773145_1177773161 29 Left 1177773145 21:25539450-25539472 CCCTCTGCCCTCCACAAGCAGTG No data
Right 1177773161 21:25539502-25539524 CCAAGCCAGCCCTGGAACCCTGG No data
1177773145_1177773159 21 Left 1177773145 21:25539450-25539472 CCCTCTGCCCTCCACAAGCAGTG No data
Right 1177773159 21:25539494-25539516 TGGTGGGGCCAAGCCAGCCCTGG No data
1177773145_1177773154 -8 Left 1177773145 21:25539450-25539472 CCCTCTGCCCTCCACAAGCAGTG No data
Right 1177773154 21:25539465-25539487 AAGCAGTGATGGGGCACGATGGG No data
1177773145_1177773156 4 Left 1177773145 21:25539450-25539472 CCCTCTGCCCTCCACAAGCAGTG No data
Right 1177773156 21:25539477-25539499 GGCACGATGGGAAGCAGTGGTGG No data
1177773145_1177773155 1 Left 1177773145 21:25539450-25539472 CCCTCTGCCCTCCACAAGCAGTG No data
Right 1177773155 21:25539474-25539496 TGGGGCACGATGGGAAGCAGTGG No data
1177773145_1177773157 5 Left 1177773145 21:25539450-25539472 CCCTCTGCCCTCCACAAGCAGTG No data
Right 1177773157 21:25539478-25539500 GCACGATGGGAAGCAGTGGTGGG No data
1177773145_1177773162 30 Left 1177773145 21:25539450-25539472 CCCTCTGCCCTCCACAAGCAGTG No data
Right 1177773162 21:25539503-25539525 CAAGCCAGCCCTGGAACCCTGGG No data
1177773145_1177773153 -9 Left 1177773145 21:25539450-25539472 CCCTCTGCCCTCCACAAGCAGTG No data
Right 1177773153 21:25539464-25539486 CAAGCAGTGATGGGGCACGATGG No data
1177773145_1177773158 6 Left 1177773145 21:25539450-25539472 CCCTCTGCCCTCCACAAGCAGTG No data
Right 1177773158 21:25539479-25539501 CACGATGGGAAGCAGTGGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177773145 Original CRISPR CACTGCTTGTGGAGGGCAGA GGG (reversed) Intergenic
No off target data available for this crispr