ID: 1177779787

View in Genome Browser
Species Human (GRCh38)
Location 21:25609703-25609725
Sequence TTTTCAATGGAGAAATCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177779783_1177779787 18 Left 1177779783 21:25609662-25609684 CCTCACATATTACTGACAAAATA No data
Right 1177779787 21:25609703-25609725 TTTTCAATGGAGAAATCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177779787 Original CRISPR TTTTCAATGGAGAAATCTGG TGG Intergenic
No off target data available for this crispr