ID: 1177780380

View in Genome Browser
Species Human (GRCh38)
Location 21:25615911-25615933
Sequence TGTTCCATACTGATGGTATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177780378_1177780380 -4 Left 1177780378 21:25615892-25615914 CCATTATTTAATATCTAACTGTT No data
Right 1177780380 21:25615911-25615933 TGTTCCATACTGATGGTATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177780380 Original CRISPR TGTTCCATACTGATGGTATT TGG Intergenic
No off target data available for this crispr