ID: 1177781754

View in Genome Browser
Species Human (GRCh38)
Location 21:25629550-25629572
Sequence AAGTGATGGTAGTAGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177781754_1177781765 11 Left 1177781754 21:25629550-25629572 CCCACATCCTACTACCATCACTT No data
Right 1177781765 21:25629584-25629606 ATTTCAACACATCAATTTTGGGG No data
1177781754_1177781763 9 Left 1177781754 21:25629550-25629572 CCCACATCCTACTACCATCACTT No data
Right 1177781763 21:25629582-25629604 GGATTTCAACACATCAATTTTGG No data
1177781754_1177781767 13 Left 1177781754 21:25629550-25629572 CCCACATCCTACTACCATCACTT No data
Right 1177781767 21:25629586-25629608 TTCAACACATCAATTTTGGGGGG No data
1177781754_1177781766 12 Left 1177781754 21:25629550-25629572 CCCACATCCTACTACCATCACTT No data
Right 1177781766 21:25629585-25629607 TTTCAACACATCAATTTTGGGGG No data
1177781754_1177781764 10 Left 1177781754 21:25629550-25629572 CCCACATCCTACTACCATCACTT No data
Right 1177781764 21:25629583-25629605 GATTTCAACACATCAATTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177781754 Original CRISPR AAGTGATGGTAGTAGGATGT GGG (reversed) Intergenic
No off target data available for this crispr