ID: 1177787883

View in Genome Browser
Species Human (GRCh38)
Location 21:25692022-25692044
Sequence ATTTACATACATAATGTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 1, 2: 1, 3: 26, 4: 311}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177787881_1177787883 18 Left 1177787881 21:25691981-25692003 CCTGGGCAACAGAGCAAGACTGT 0: 907
1: 9586
2: 39367
3: 94481
4: 164721
Right 1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG 0: 1
1: 1
2: 1
3: 26
4: 311
1177787880_1177787883 22 Left 1177787880 21:25691977-25691999 CCAGCCTGGGCAACAGAGCAAGA 0: 19870
1: 65461
2: 149698
3: 191149
4: 205218
Right 1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG 0: 1
1: 1
2: 1
3: 26
4: 311

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177787883 Original CRISPR ATTTACATACATAATGTGGA AGG Intronic
904834486 1:33326107-33326129 ATTTTCAGGCAGAATGTGGAAGG + Intronic
906252011 1:44318024-44318046 ATGCACATACATAATTTGGAGGG - Intronic
907383088 1:54107550-54107572 ATCTACCTATATAATTTGGAAGG + Intronic
907693776 1:56700051-56700073 ATTTACATACACAGTTTGTATGG + Intronic
908235898 1:62147148-62147170 ATTTACATTCATGAGATGGATGG + Intronic
908895185 1:68890493-68890515 ACATACAAACATAATGTTGAAGG + Intergenic
912574793 1:110658672-110658694 TTTTACATATATAATTTTGAAGG + Intergenic
913233330 1:116760058-116760080 ATTTACAGACAAAATGTTCAAGG - Intronic
913392699 1:118332118-118332140 ATTACCCTCCATAATGTGGATGG - Intergenic
921462685 1:215447465-215447487 ATTTTCTTAGATATTGTGGATGG + Intergenic
921954673 1:220969731-220969753 ATGTACATACACCATGTGGCAGG - Intergenic
922118877 1:222643092-222643114 ATTTTGATACATAATTAGGAAGG + Intronic
922332665 1:224590969-224590991 ATATAGAAACATAATGTGGGAGG + Intronic
923093125 1:230754323-230754345 ATATACATATACAATATGGAGGG - Intronic
1062788606 10:286001-286023 ATTTAAACACATAATGTGTATGG - Intronic
1063624858 10:7679471-7679493 ATTTTCCTTCATAATGTGGGTGG - Intergenic
1063797729 10:9532044-9532066 ATTAAAACACATACTGTGGAAGG + Intergenic
1064749853 10:18516504-18516526 ATTTACATTCATAATTTCAACGG + Intronic
1065453848 10:25885630-25885652 ATTATCATCCATAATGTGGGTGG + Intergenic
1065719146 10:28608702-28608724 TTCTATATACATAATGTGTATGG + Intronic
1068141813 10:53018851-53018873 ATTAACTTTCATAAAGTGGATGG + Intergenic
1069185091 10:65412440-65412462 ATTGTCCTTCATAATGTGGATGG + Intergenic
1069236316 10:66079557-66079579 ATTTCCATAAACAATTTGGAGGG - Intronic
1069384042 10:67868301-67868323 TTTCACATATATAAAGTGGAGGG - Intergenic
1071687366 10:87774065-87774087 TTTCACAAACATAATGTAGAAGG + Intronic
1071755382 10:88532551-88532573 ATTCACATAAATTCTGTGGAGGG + Intronic
1072825418 10:98601195-98601217 ATTACCCTCCATAATGTGGATGG - Intronic
1073505149 10:103979985-103980007 AATTACACACCTAATGTAGAAGG - Intronic
1073637133 10:105210858-105210880 ATTGATATAAATAATGTGGCAGG - Intronic
1074720836 10:116263797-116263819 AGTTACATCCATGATGTGGAAGG + Intronic
1075265058 10:120993388-120993410 ATTTACATGCAAAATGTGCAAGG + Intergenic
1075449727 10:122542061-122542083 ATTAACAGACATAAAGAGGATGG - Intergenic
1075642710 10:124076215-124076237 ATACACACACATAATGTAGATGG + Intronic
1077801608 11:5544666-5544688 ATTGGCAAACATGATGTGGAAGG + Exonic
1078974697 11:16459861-16459883 ATATACATGTATAATATGGAGGG + Intronic
1079520412 11:21319808-21319830 ATTGATATAGGTAATGTGGAAGG + Intronic
1079892068 11:26068232-26068254 ATTAAATTAAATAATGTGGATGG - Intergenic
1080118957 11:28653500-28653522 ATTAACATAAATAATGTAAAGGG + Intergenic
1080216116 11:29843134-29843156 ATTTACATGTATAAAGTGGTAGG + Intergenic
1080758874 11:35228479-35228501 ATTTACAATCATCATGTTGATGG + Intronic
1086578685 11:88370739-88370761 ATGAACGAACATAATGTGGATGG + Intergenic
1087377321 11:97360759-97360781 ATTTTCCTCCATAATGTGAATGG - Intergenic
1088456403 11:110036968-110036990 ATTGCCCTACATAATGTGGGTGG + Intergenic
1089330709 11:117687067-117687089 GTCTACATGCAGAATGTGGATGG + Intronic
1091162298 11:133435713-133435735 ATTTCCATAAATAATGAAGATGG + Intronic
1091717360 12:2788577-2788599 TTTCACAAACATAATGTGGAAGG + Intergenic
1092356614 12:7800768-7800790 ATTTAAACATATAATGTGGCTGG - Intergenic
1092463336 12:8705932-8705954 ATTACCCTCCATAATGTGGAGGG - Intronic
1092578057 12:9811801-9811823 TTTTACATACATACTGAGCAGGG + Intergenic
1092664171 12:10776204-10776226 ATTTATATACATATTTGGGAAGG - Intergenic
1093006893 12:14060915-14060937 TTTTACATAGATAAGGTGGAGGG - Intergenic
1095265515 12:40152451-40152473 GTTAACATACATATTGTGGAAGG + Intergenic
1095620098 12:44242679-44242701 ATATACATATATAATATGTATGG - Intronic
1097254390 12:57661773-57661795 GTTTACATACAAGATGTGTAGGG + Intergenic
1097463876 12:59898443-59898465 ATCACCATCCATAATGTGGATGG - Intergenic
1097885366 12:64723632-64723654 ATGTACATTCATGGTGTGGAAGG + Intronic
1099064975 12:77964512-77964534 ATTTACAAGAATACTGTGGATGG + Intronic
1102617231 12:114165304-114165326 ATTTAAATACAGTATGTGGAAGG + Intergenic
1102902703 12:116650799-116650821 ATTTAAAAACATTATGTGGAAGG - Intergenic
1108018228 13:46098054-46098076 ACTTACATACTGAATGTGGCAGG + Intronic
1108115659 13:47124798-47124820 ATTTACAAACTTAATGTAGTGGG - Intergenic
1108972403 13:56393442-56393464 ATTTAGATATAAATTGTGGAAGG + Intergenic
1109775914 13:67040699-67040721 ATTGAAATACAGAATGTGGTGGG + Intronic
1110032591 13:70635228-70635250 ATTTAAATACAATATTTGGATGG - Intergenic
1111082762 13:83334032-83334054 ATTTATACACATAATATAGAGGG + Intergenic
1111306248 13:86416590-86416612 AGTTACATACAAAAATTGGATGG - Intergenic
1111344549 13:86933616-86933638 ATTTGCATACAAATTGTGGTTGG + Intergenic
1112111493 13:96304618-96304640 AATAACATATATAATGTGGAAGG + Intronic
1112812204 13:103231888-103231910 TTTTAAAGACAAAATGTGGAGGG - Intergenic
1115027853 14:28764791-28764813 AGATACATACATACAGTGGAAGG + Intergenic
1116131296 14:40857875-40857897 ACTTACATACAAGATGTGTAAGG + Intergenic
1116268168 14:42723158-42723180 ATTTCCATTCATAATCTTGAAGG - Intergenic
1116791554 14:49345279-49345301 AAGTACTTCCATAATGTGGAAGG + Intergenic
1117197788 14:53358374-53358396 ATTACCATCCATAATGTGGGTGG - Intergenic
1119151420 14:72363234-72363256 ATTCACATCCATGAAGTGGATGG + Intronic
1120069610 14:80088508-80088530 ATTTAAATGCTTTATGTGGAGGG + Intergenic
1120644390 14:87055783-87055805 ATTTACTTACATATTGTATATGG - Intergenic
1121153631 14:91662336-91662358 ATTTAAGTAAATAATGTTGAGGG - Intronic
1121673883 14:95736416-95736438 ATTCACAAACATAAGGTTGAGGG + Intergenic
1124061888 15:26300840-26300862 AATTCCAAACATAAAGTGGAGGG + Intergenic
1124479284 15:30063787-30063809 ATTTCCCTTCATAATGTGCATGG + Intergenic
1125040972 15:35187035-35187057 ATCTTATTACATAATGTGGAAGG + Intergenic
1125678893 15:41518227-41518249 ATATACATACATAAGGTGTGTGG + Intronic
1125704554 15:41722035-41722057 TTTTACAAATATAATGTTGAAGG + Intronic
1126750391 15:51870975-51870997 ATTAACCTCCATAATGTGGGTGG - Intronic
1127594023 15:60459939-60459961 ATTTACATCCATTATGATGACGG - Intronic
1130807373 15:87339590-87339612 AGTTACATACATATTATGTAAGG + Intergenic
1131514806 15:93070179-93070201 ATTTACTTACTCCATGTGGATGG - Intronic
1132451354 15:101970348-101970370 ATATAAATACAGAAGGTGGAGGG - Intergenic
1133131825 16:3680813-3680835 ATCTTCATACAGAAGGTGGAAGG - Intronic
1138985737 16:62326429-62326451 ATTTAGAAACATCATGTGAATGG + Intergenic
1140929747 16:79616362-79616384 ATATACTTACATAATGTATAGGG + Intergenic
1141077064 16:81016463-81016485 ATCTAAATAAATAATGTGGCTGG + Intronic
1143017142 17:3896889-3896911 GTTCACATACACAGTGTGGAAGG + Exonic
1143528889 17:7489184-7489206 ATATGCATAGATAATGTAGAAGG + Intronic
1143813230 17:9489484-9489506 CTTTACATGCATAATTTGGTGGG - Intronic
1144715124 17:17429039-17429061 ATTTACATGTAAAATGTGTAAGG + Intergenic
1148550700 17:48549202-48549224 ATATAAATACATAATGTAGGGGG + Exonic
1149138329 17:53397999-53398021 ATTTACACAAGTAATGTGAATGG + Intergenic
1149145052 17:53480317-53480339 TTTTACTTAGATAATATGGAGGG - Intergenic
1149543804 17:57488373-57488395 ATTTAAATACATAATATAGTAGG - Intronic
1150931672 17:69591533-69591555 ATTTACAAACATAACTGGGAAGG - Intergenic
1153326869 18:3829726-3829748 ATTACCCTCCATAATGTGGATGG - Intronic
1153330354 18:3867350-3867372 ATTTTATTACATAATTTGGAAGG - Intronic
1153576008 18:6522689-6522711 ATTTCCATACACAATATGAATGG + Intronic
1153852226 18:9106162-9106184 ATTTATATACAGAATGTATAGGG + Intronic
1154295260 18:13141698-13141720 ACATACATACATAATGTCCAAGG - Intergenic
1154299573 18:13181322-13181344 ATTGACATGCATATTGTGTATGG - Intergenic
1154383719 18:13874916-13874938 ATATGCATACAGAATCTGGAAGG + Intergenic
1155109749 18:22702470-22702492 AATTAAAGACATAATATGGAAGG - Intergenic
1156636205 18:39032488-39032510 TTTTACACAGATAGTGTGGAGGG + Intergenic
1158031477 18:52970641-52970663 ATTCACACACATTATCTGGAAGG - Intronic
1158103321 18:53855633-53855655 ATTTAAATATATAATTTGTATGG - Intergenic
1159299469 18:66544050-66544072 CTTCAAATACATAATATGGAAGG + Exonic
1159636886 18:70815583-70815605 ATTTCCATACATAAAGTGCTCGG - Intergenic
1160109745 18:76015345-76015367 ATTTAGATGCAAAATGTAGAAGG - Intergenic
1162446554 19:10726583-10726605 ATTTACACACATTTTGTGTACGG + Intronic
1163048620 19:14663951-14663973 ATTTACATATATAATATGTCAGG - Intronic
1163399563 19:17083956-17083978 ATTTAAATACACAAAGTGAATGG + Intronic
1164901831 19:31934045-31934067 TCTTACAAACATAATGTTGAGGG + Intergenic
1165501109 19:36190175-36190197 AAATACATACAGAATGTGGTAGG + Intronic
1166890037 19:45985668-45985690 ATGTACATATATAATATTGAAGG - Intergenic
1167850151 19:52195108-52195130 ATATACATTCATATTATGGAAGG + Intronic
924983627 2:247104-247126 CTTTACTTAAAGAATGTGGAGGG + Intronic
925251514 2:2442791-2442813 AATTACATATATTTTGTGGAAGG - Intergenic
925855431 2:8124842-8124864 ATTAACATATATTATGTGGATGG - Intergenic
927449196 2:23192110-23192132 ATGTGCATTCACAATGTGGATGG + Intergenic
928594618 2:32848079-32848101 ATTTACAAACAAAATGATGAGGG - Intergenic
928728420 2:34202911-34202933 ATGTACATACATAAAATAGAAGG - Intergenic
928954744 2:36852858-36852880 ATTTAAATATAAAATGTGGCTGG + Intronic
929216706 2:39421838-39421860 ATTTAAATGGATAAAGTGGAAGG - Intronic
929226856 2:39520020-39520042 ATTATGATTCATAATGTGGATGG + Intergenic
929324722 2:40595408-40595430 ATTTGCATTCAAAATGTAGATGG + Intronic
929803723 2:45126721-45126743 ATTTGCATTCACAAAGTGGAGGG + Intergenic
930630358 2:53746779-53746801 TTGTAAAAACATAATGTGGAAGG - Intronic
931020200 2:58035810-58035832 ATTTTCACACATAACGTGGTTGG - Intronic
931216930 2:60253959-60253981 CTATACATACATAATATGTAAGG + Intergenic
931829836 2:66039224-66039246 ATTACCCTCCATAATGTGGATGG - Intergenic
932023023 2:68107301-68107323 ATTTACTTAGAAAATGTGCATGG - Intronic
932089762 2:68796478-68796500 ATTTACATTCATTATGGGGTGGG + Intronic
932890111 2:75587180-75587202 ATTTAATTACCTAATCTGGATGG + Intergenic
934982792 2:98859892-98859914 ATGCACATAGATAATGTTGAGGG + Intronic
936923640 2:117714580-117714602 ATTTACTTAAAGAAGGTGGAGGG - Intergenic
937678622 2:124619612-124619634 ATTGACCTCCATAATGGGGATGG + Intronic
939471801 2:142631581-142631603 CTTTCCATATATAATGTGGCAGG - Intergenic
939471892 2:142633176-142633198 CTTTCCATATATAATGTGGCAGG + Intergenic
939743617 2:145941560-145941582 ATGTACATATACAATGTGAAAGG + Intergenic
940510966 2:154614274-154614296 AGTTAGATAATTAATGTGGATGG - Intergenic
941299525 2:163784136-163784158 ATTTACATTCAAAATATGAAAGG + Intergenic
941978149 2:171427862-171427884 TTTTTCATCCATAATGTGCAGGG - Intronic
942671808 2:178383940-178383962 TTTTACACACCTCATGTGGATGG - Intronic
942788766 2:179733945-179733967 ATATACATACATATGGGGGAAGG - Intronic
943043897 2:182835321-182835343 ATTTACACACAGAATTTGAAGGG + Intronic
943541485 2:189220304-189220326 CTTTACACACATAATGAAGAAGG - Intergenic
943766953 2:191673405-191673427 TTTTTCATACACAATGTGAAAGG + Intergenic
944330407 2:198458787-198458809 ATTTACATGCAGAATTTAGAGGG + Intronic
944997445 2:205309988-205310010 ATATATATACACAATGTGGAAGG + Intronic
946140821 2:217689217-217689239 ATTTCCCTCCATAATGTGGGTGG + Intronic
946594551 2:221291934-221291956 CTTCCCATACATAATGAGGATGG - Intergenic
1169543908 20:6631073-6631095 ATTCACAGCCATAATGTGGGAGG + Intergenic
1170762061 20:19259714-19259736 ATTTTCATATATAATGTTGGGGG - Intronic
1171946326 20:31381486-31381508 ATTGATACACATAGTGTGGATGG + Intronic
1172459895 20:35109653-35109675 ATTACCCTTCATAATGTGGATGG - Intergenic
1172827484 20:37802766-37802788 ATTTAGATGTATAATGTGTACGG + Intronic
1173155871 20:40608201-40608223 ATTAAAATAAACAATGTGGAGGG - Intergenic
1177061047 21:16374510-16374532 ATTTATTTACATAGTGTGGGTGG - Intergenic
1177317885 21:19484053-19484075 GTTTACAAACATAATCTTGATGG - Intergenic
1177486952 21:21770753-21770775 ATTTACATATGAAAAGTGGAAGG - Intergenic
1177625840 21:23658106-23658128 ATTTACATAAATTATTTTGAAGG + Intergenic
1177787883 21:25692022-25692044 ATTTACATACATAATGTGGAAGG + Intronic
1178258059 21:31073428-31073450 CTTTACATTTATTATGTGGAAGG - Intergenic
1179311865 21:40203265-40203287 ATCTGCAAACATAAGGTGGAAGG - Intronic
951385851 3:22041500-22041522 TTTAAAATACAGAATGTGGAAGG + Intronic
951966351 3:28389917-28389939 ATTAACTTCCATAATGTGGGTGG - Intronic
952580091 3:34823296-34823318 CTTTAAATAAATAATGTTGAGGG + Intergenic
952594413 3:34998773-34998795 ATTTACATGCAGAAGATGGAAGG - Intergenic
953377209 3:42438678-42438700 ATCTACATACCTACTGTGCAGGG + Intergenic
954095059 3:48319773-48319795 AATTATATACATATTGTGGGTGG - Intronic
954970007 3:54643689-54643711 ATAAACATACATGATGTGAAAGG + Intronic
955183925 3:56697065-56697087 ATAGACATGCATAAGGTGGAGGG - Intergenic
955668538 3:61376688-61376710 TCTTACAGACATAATGTTGAGGG - Intergenic
955702057 3:61691489-61691511 ATATACATACATATTTAGGATGG - Intronic
955982215 3:64538741-64538763 ATTTAGTGACATAATGTTGACGG + Intronic
956614510 3:71157635-71157657 ATTTACATACTTAATGCTGTGGG - Intronic
957331359 3:78768608-78768630 ATGTACATATATATTGTTGAAGG + Intronic
958116700 3:89229352-89229374 ATTTACATAAATAATTAGGCAGG - Intronic
958503190 3:94940965-94940987 ATATATATACATAATATGCAGGG + Intergenic
959234618 3:103703791-103703813 ATATATATATATAATGTGCATGG + Intergenic
959297211 3:104551694-104551716 CTTTTTATACATAATGTGGCAGG + Intergenic
959366713 3:105469450-105469472 ATTTATATAAATAATGTTCATGG - Intronic
959916438 3:111821584-111821606 GTTTACCTCCATATTGTGGATGG - Intronic
962473956 3:135739727-135739749 ATTCAAATGCATAAAGTGGAGGG - Intergenic
962658186 3:137570876-137570898 ATTTACATACATGAATTGGAAGG - Intergenic
962930470 3:140031220-140031242 CTTCACATGCAGAATGTGGAGGG + Intronic
963190086 3:142460685-142460707 GTTTTCATACATAATTTGTATGG - Intronic
963435718 3:145263191-145263213 ATTGACATACATTAAGTGTATGG - Intergenic
964011035 3:151892072-151892094 ATACACATACATAAAGTGGTCGG + Intergenic
964268748 3:154931644-154931666 ATTTTCATGCATACAGTGGAAGG + Intergenic
964968285 3:162526304-162526326 ATTTACTTACATTTTGTGTATGG - Intergenic
965434602 3:168633524-168633546 ATTGACACACATAAGGTGAAGGG - Intergenic
965532417 3:169786252-169786274 ATTTACATAGATAGTGAGGAGGG + Intronic
965946746 3:174251738-174251760 GTATAAATACATAATGTAGATGG - Intronic
966008821 3:175051141-175051163 ATTTTCATAGATGATGTGTATGG + Intronic
970325821 4:14924730-14924752 ATTATCCTCCATAATGTGGATGG - Intergenic
971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG + Intergenic
971905389 4:32717790-32717812 ATTACCCTACATAATATGGAAGG - Intergenic
973051173 4:45599585-45599607 ATTACCCTCCATAATGTGGATGG - Intergenic
973147728 4:46848741-46848763 GTTTACATACATAATATATATGG + Intronic
973933849 4:55821610-55821632 AGTTAATTACATAATTTGGAGGG - Intergenic
974295794 4:59997476-59997498 ATTTACATACAATGTGTGTAAGG - Intergenic
974833900 4:67223138-67223160 ATAGCCATCCATAATGTGGATGG - Intergenic
974886922 4:67830866-67830888 ATTTACATATAAAATGTGATTGG + Intronic
978089695 4:104700016-104700038 ATTTACAAACATTAGGTTGAAGG - Intergenic
978900343 4:113941622-113941644 AATTAAATATATAATGTGTAAGG + Intronic
979002853 4:115247625-115247647 ATTTACCTCCATAATGTGGATGG + Intergenic
979378703 4:119982083-119982105 ATTAACCTCCATAATGTGGATGG + Intergenic
980575083 4:134676852-134676874 ATTTACATATATAGTCTGAAAGG - Intergenic
981088512 4:140708730-140708752 CCTTTCATACATAATGTGGCTGG - Intronic
981184115 4:141780833-141780855 ATTTACATCTCTAATATGGATGG - Intergenic
981513669 4:145584622-145584644 ATTTACTTGCAAAATGTGTAGGG + Intergenic
982640847 4:157958254-157958276 ATTTATTTACATAATGTCTATGG + Intergenic
982781087 4:159492190-159492212 ATTTAGATATAAAATTTGGATGG + Intergenic
982920358 4:161266819-161266841 ATTCACACACATACTGTGCAAGG - Intergenic
983093095 4:163529141-163529163 GTTAACATACATAATCTAGAAGG - Intronic
983857223 4:172661153-172661175 ATTACCCTCCATAATGTGGATGG + Intronic
984793259 4:183633506-183633528 ATCTACACAAATAATGTGGCAGG + Intergenic
986693762 5:10334173-10334195 AAATACATAAATAAGGTGGAAGG + Intergenic
986775738 5:11012323-11012345 ACTTGGATACATAAAGTGGAAGG + Intronic
988078880 5:26390130-26390152 ATTTACATAAAATATCTGGATGG + Intergenic
989793440 5:45436411-45436433 ATTTACATACTTCATATGGGAGG + Intronic
990766155 5:59185462-59185484 ATGTGCATAGACAATGTGGAGGG - Intronic
990931753 5:61099448-61099470 ATTTAAATACATAATATTAAGGG - Intronic
992210387 5:74473949-74473971 ATTAGTATACATAATGTGAATGG - Intergenic
993282601 5:85945927-85945949 ATTTAAATACATAATTTGCCTGG - Intergenic
994526310 5:100909232-100909254 ATTTACCGCCATAATGTGGGTGG - Intergenic
994857295 5:105139831-105139853 ATTACCCTCCATAATGTGGATGG + Intergenic
996156598 5:120110421-120110443 ATTTACATATTTAATTTTGAGGG + Intergenic
996795711 5:127344180-127344202 ATATACATACATAATCTTTAGGG - Intronic
997093424 5:130883444-130883466 ATTACCCTACATAATGTGGGTGG - Intergenic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
997636943 5:135417494-135417516 ATTTACCTATATCATGTTGAGGG + Intergenic
998432593 5:142079131-142079153 ATATACATATATAATGAGAAAGG + Intergenic
998864199 5:146478703-146478725 ATTTTGATAGAAAATGTGGAAGG + Intronic
1001830526 5:174784479-174784501 AATAACAAACATAAGGTGGAGGG - Intergenic
1003124593 6:3346340-3346362 ATTAACAGACATGAAGTGGATGG - Intronic
1003908935 6:10726199-10726221 TTTTACATACAGAACATGGAAGG + Intronic
1004785862 6:18966522-18966544 ATTACCCTACATAATGTGGGTGG - Intergenic
1006055542 6:31381841-31381863 ATTACCATCAATAATGTGGATGG - Intergenic
1006274786 6:32994728-32994750 ATTTAAATAAATAATGTAAATGG - Intergenic
1007755844 6:44098916-44098938 TTTTACATAAATAATGTGTGTGG + Intergenic
1008901967 6:56630680-56630702 AATTACATGCAAAATGTGGGAGG + Intronic
1009501246 6:64417476-64417498 ATTTAGATACATATTGTTGGTGG + Intronic
1010013195 6:71073792-71073814 ATTTACTTATATAATTTGGTGGG + Intergenic
1010882380 6:81194037-81194059 ATTTACTTACATAATGTGGAAGG - Intergenic
1011476701 6:87755628-87755650 ACATACATACATATTGTAGAAGG - Intergenic
1011983025 6:93408717-93408739 AGTTAAATACTTCATGTGGATGG - Intronic
1014394716 6:120912123-120912145 ATTGCCTTTCATAATGTGGATGG + Intergenic
1014959361 6:127663541-127663563 TTTTAGATACTTGATGTGGATGG + Intergenic
1015231681 6:130921958-130921980 ATTTACATATAGGATGTTGAAGG - Intronic
1016193752 6:141304844-141304866 AGTTACAGACATAATATGAAGGG - Intergenic
1016568336 6:145484570-145484592 AATTACATACAGAATGTAGATGG - Intergenic
1016970268 6:149755664-149755686 TTTTACATATATAATGTTTATGG + Intronic
1017104824 6:150877518-150877540 AATTACAAAGATAATATGGAAGG - Intronic
1017656772 6:156637035-156637057 ATATACATATATAATGTCTAGGG - Intergenic
1017687668 6:156929326-156929348 ATCTACACACAGAAAGTGGAGGG + Intronic
1018552379 6:165012486-165012508 ATTTTCATGCAGAATGGGGAAGG - Intergenic
1018802033 6:167230625-167230647 CTTTACATACATGGTGTGTAGGG + Intergenic
1020868169 7:13591765-13591787 ATTTACGAACATAATTTTGAGGG - Intergenic
1022970852 7:35515496-35515518 CTTTAGATACCTAATGTGGGTGG + Intergenic
1023430074 7:40082162-40082184 CTTTTCACACATAATGTCGAAGG - Intronic
1024120139 7:46228190-46228212 ATTGCCCTACATAATGTGGATGG - Intergenic
1024945288 7:54801895-54801917 ATTTATATACAGGAGGTGGATGG - Intergenic
1025771079 7:64507652-64507674 ATATACCTATATAATATGGATGG - Intergenic
1028508472 7:91595868-91595890 ATTAACCTCCATAATGTGGGTGG - Intergenic
1029252453 7:99246695-99246717 ATTTATATATATTTTGTGGATGG - Intergenic
1031505635 7:122578583-122578605 ATTTGCATATCTAATGTGCAGGG + Intronic
1032316922 7:130846649-130846671 ATTTCCCTTCATAATGTGGATGG - Intergenic
1032880426 7:136084183-136084205 ATTACCCTTCATAATGTGGACGG - Intergenic
1032912415 7:136448629-136448651 ATGTTCATATATAATGTGGCGGG - Intergenic
1033581697 7:142743224-142743246 ATTAACTTACATAATGTACAAGG - Intergenic
1034259181 7:149743904-149743926 ATTTACATCCAGAATGTGCCAGG + Intergenic
1035441082 7:158900667-158900689 ATTCACATGTATAATGGGGATGG - Intronic
1035972065 8:4259479-4259501 ATTTTCATACATAAAGTTTATGG + Intronic
1037828275 8:22173050-22173072 ATTTACTTGCATATTATGGAAGG + Intronic
1038172633 8:25151326-25151348 AAATAAATAAATAATGTGGATGG + Intergenic
1039336363 8:36594807-36594829 AGTTACTTACAGAGTGTGGATGG - Intergenic
1039682971 8:39762614-39762636 ATTATCCTAGATAATGTGGATGG + Intronic
1040675523 8:49744711-49744733 ATTAACCTCCATAATGTGGGTGG + Intergenic
1040676981 8:49762226-49762248 ATTTGGATACATTATGTGGTTGG - Intergenic
1040861533 8:52004442-52004464 GTCTAAATAAATAATGTGGAAGG + Intergenic
1040957583 8:52995475-52995497 ATTTACATAGCTTATGGGGAAGG - Intergenic
1041140033 8:54807914-54807936 ATTGCCTTCCATAATGTGGACGG - Intergenic
1041180293 8:55240389-55240411 ATTTACAGACATAATGCTGAAGG + Intronic
1042421776 8:68599542-68599564 CTTTACATACATAGTCTGAAAGG + Intronic
1042969695 8:74394645-74394667 ATTGACATATATAGTGTGAATGG - Intronic
1043084725 8:75814807-75814829 ATATCCTTCCATAATGTGGAAGG - Intergenic
1043522381 8:81060084-81060106 ATTTACTTGCTTAATTTGGATGG - Intronic
1044007349 8:86954619-86954641 ATTTACATACAAAGTGTGTAAGG - Intronic
1044095904 8:88064104-88064126 ATTTATTTACATATTGTGTATGG + Intronic
1044133453 8:88556069-88556091 ATTTCCCTTCCTAATGTGGATGG + Intergenic
1044248072 8:89974003-89974025 ATTTAAATAGAAAATGTGAATGG - Intronic
1044389995 8:91638815-91638837 ATTTACATCTATAATGTAGAGGG + Intergenic
1045171460 8:99674858-99674880 AATAACATTCAAAATGTGGAGGG - Intronic
1045631696 8:104131543-104131565 ATTTTCATATATCATGTGAATGG - Intronic
1047774097 8:128054921-128054943 ATTATCTTCCATAATGTGGATGG + Intergenic
1047948958 8:129912124-129912146 ATTTACACACATAATTTTAAAGG + Intronic
1048476739 8:134749651-134749673 TTTTACATACAGTATGAGGAAGG + Intergenic
1050013191 9:1206356-1206378 AATTAAATACATTATGTGAAAGG + Intergenic
1050673982 9:8030951-8030973 AAATACATACCTAATGTAGATGG - Intergenic
1052523976 9:29588855-29588877 ATTTCAACACATAATTTGGATGG - Intergenic
1052718092 9:32143056-32143078 ACTTATAAACATAATGTTGATGG + Intergenic
1053472208 9:38354999-38355021 ATTTTCATACCTAATGTTGGAGG - Intergenic
1055674539 9:78642512-78642534 ATGTACATATATATTGTTGAAGG - Intergenic
1055962158 9:81830937-81830959 ATTAACGTGAATAATGTGGAAGG + Intergenic
1056268128 9:84920183-84920205 ATTCACATTCATAAGGTGGAGGG + Intronic
1056879804 9:90380307-90380329 ATTTATCTACAGAATGTGGCAGG + Intergenic
1056898286 9:90572255-90572277 ATGTACATACATAAAGAGGAAGG + Intergenic
1057609067 9:96524638-96524660 AGTTCCCTCCATAATGTGGATGG + Intronic
1059025082 9:110618211-110618233 ATATCCATATATAATGTTGATGG - Intergenic
1186365689 X:8890961-8890983 ATTTCCCTACATAATGTGGGTGG + Intergenic
1186568016 X:10685450-10685472 TTTTACACAGATAAGGTGGAGGG - Intronic
1186863281 X:13694317-13694339 AAATACATACATAATGTGGTTGG + Intronic
1188068305 X:25688387-25688409 ATGTACATACAAAATGAGGCTGG + Intergenic
1189654103 X:43223385-43223407 ATTTACTTACTTAATGTTGCAGG - Intergenic
1189710367 X:43804784-43804806 ATTAACTTCCATAATGTGAATGG - Intronic
1192596597 X:72414777-72414799 ATTTGCATCCATCATGTGTATGG - Intronic
1192789143 X:74364071-74364093 ATTACCATCCATAATGTGGGTGG + Intergenic
1192824879 X:74684527-74684549 ATTACCCTTCATAATGTGGATGG + Intergenic
1193902668 X:87202192-87202214 ATTTACCTCCCTAATGTGGATGG + Intergenic
1194616568 X:96110854-96110876 ATTTCTAAACAAAATGTGGAAGG - Intergenic
1194678537 X:96822938-96822960 AGTTACATATATGATGTGCATGG + Intronic
1194908354 X:99607734-99607756 ATTGCCCTCCATAATGTGGATGG + Intergenic
1197137963 X:123084776-123084798 ATATACAAACATAATCAGGAGGG - Intergenic
1197189133 X:123625392-123625414 GTTTAAAAACATAATGTGGCCGG - Intronic
1198371581 X:135994504-135994526 ATTTAAATAAGTAATGAGGAAGG - Intronic
1198845885 X:140910035-140910057 ATTACCCTCCATAATGTGGATGG + Intergenic
1199951444 X:152709103-152709125 TTTAACTTCCATAATGTGGATGG - Intergenic
1199958239 X:152759358-152759380 TTTAACTTCCATAATGTGGATGG + Intergenic
1201181346 Y:11350118-11350140 ATTTAAAGACATAATGTCAAAGG - Intergenic
1202020223 Y:20457050-20457072 ATTTACTTGCACAATGTGCATGG - Intergenic