ID: 1177788221

View in Genome Browser
Species Human (GRCh38)
Location 21:25695453-25695475
Sequence AGAACGGGCCATGATGACGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2600
Summary {0: 414, 1: 1018, 2: 754, 3: 186, 4: 228}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177788221_1177788236 27 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788236 21:25695503-25695525 ACGGGGCGGCCGCGGGGCAGAGG 0: 1
1: 7
2: 165
3: 2596
4: 4680
1177788221_1177788233 21 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788233 21:25695497-25695519 TCCCAGACGGGGCGGCCGCGGGG 0: 1
1: 26
2: 464
3: 4230
4: 10946
1177788221_1177788224 -8 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788224 21:25695468-25695490 CCCGTTCTCAATGAGCTGTTGGG 0: 1295
1: 586
2: 145
3: 41
4: 71
1177788221_1177788238 29 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788238 21:25695505-25695527 GGGGCGGCCGCGGGGCAGAGGGG 0: 1
1: 4
2: 112
3: 1191
4: 3316
1177788221_1177788229 13 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788229 21:25695489-25695511 GGTACACCTCCCAGACGGGGCGG 0: 912
1: 1046
2: 220
3: 50
4: 1332
1177788221_1177788231 19 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788231 21:25695495-25695517 CCTCCCAGACGGGGCGGCCGCGG 0: 1
1: 2
2: 85
3: 120
4: 235
1177788221_1177788226 8 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788226 21:25695484-25695506 TGTTGGGTACACCTCCCAGACGG 0: 1065
1: 787
2: 161
3: 187
4: 172
1177788221_1177788222 -9 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788222 21:25695467-25695489 GCCCGTTCTCAATGAGCTGTTGG 0: 1290
1: 604
2: 139
3: 40
4: 84
1177788221_1177788227 9 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788227 21:25695485-25695507 GTTGGGTACACCTCCCAGACGGG 0: 990
1: 915
2: 379
3: 77
4: 88
1177788221_1177788228 10 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788228 21:25695486-25695508 TTGGGTACACCTCCCAGACGGGG 0: 920
1: 956
2: 411
3: 80
4: 169
1177788221_1177788232 20 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788232 21:25695496-25695518 CTCCCAGACGGGGCGGCCGCGGG 0: 3
1: 105
2: 1073
3: 5153
4: 3555
1177788221_1177788237 28 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG 0: 1
1: 4
2: 98
3: 1114
4: 3029

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177788221 Original CRISPR AGAACGGGCCATGATGACGA TGG (reversed) Intronic
Too many off-targets to display for this crispr