ID: 1177788225

View in Genome Browser
Species Human (GRCh38)
Location 21:25695469-25695491
Sequence ACCCAACAGCTCATTGAGAA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2148
Summary {0: 1045, 1: 721, 2: 149, 3: 73, 4: 160}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177788225_1177788227 -7 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788227 21:25695485-25695507 GTTGGGTACACCTCCCAGACGGG 0: 990
1: 915
2: 379
3: 77
4: 88
1177788225_1177788228 -6 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788228 21:25695486-25695508 TTGGGTACACCTCCCAGACGGGG 0: 920
1: 956
2: 411
3: 80
4: 169
1177788225_1177788226 -8 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788226 21:25695484-25695506 TGTTGGGTACACCTCCCAGACGG 0: 1065
1: 787
2: 161
3: 187
4: 172
1177788225_1177788238 13 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788238 21:25695505-25695527 GGGGCGGCCGCGGGGCAGAGGGG 0: 1
1: 4
2: 112
3: 1191
4: 3316
1177788225_1177788231 3 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788231 21:25695495-25695517 CCTCCCAGACGGGGCGGCCGCGG 0: 1
1: 2
2: 85
3: 120
4: 235
1177788225_1177788236 11 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788236 21:25695503-25695525 ACGGGGCGGCCGCGGGGCAGAGG 0: 1
1: 7
2: 165
3: 2596
4: 4680
1177788225_1177788232 4 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788232 21:25695496-25695518 CTCCCAGACGGGGCGGCCGCGGG 0: 3
1: 105
2: 1073
3: 5153
4: 3555
1177788225_1177788233 5 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788233 21:25695497-25695519 TCCCAGACGGGGCGGCCGCGGGG 0: 1
1: 26
2: 464
3: 4230
4: 10946
1177788225_1177788237 12 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788237 21:25695504-25695526 CGGGGCGGCCGCGGGGCAGAGGG 0: 1
1: 4
2: 98
3: 1114
4: 3029
1177788225_1177788229 -3 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788229 21:25695489-25695511 GGTACACCTCCCAGACGGGGCGG 0: 912
1: 1046
2: 220
3: 50
4: 1332

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177788225 Original CRISPR ACCCAACAGCTCATTGAGAA CGG (reversed) Intronic
Too many off-targets to display for this crispr