ID: 1177788226

View in Genome Browser
Species Human (GRCh38)
Location 21:25695484-25695506
Sequence TGTTGGGTACACCTCCCAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2372
Summary {0: 1065, 1: 787, 2: 161, 3: 187, 4: 172}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177788218_1177788226 30 Left 1177788218 21:25695431-25695453 CCTTTTCTATTCGACAAAACCGC 0: 216
1: 973
2: 471
3: 145
4: 91
Right 1177788226 21:25695484-25695506 TGTTGGGTACACCTCCCAGACGG 0: 1065
1: 787
2: 161
3: 187
4: 172
1177788221_1177788226 8 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788226 21:25695484-25695506 TGTTGGGTACACCTCCCAGACGG 0: 1065
1: 787
2: 161
3: 187
4: 172
1177788223_1177788226 -7 Left 1177788223 21:25695468-25695490 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1177788226 21:25695484-25695506 TGTTGGGTACACCTCCCAGACGG 0: 1065
1: 787
2: 161
3: 187
4: 172
1177788225_1177788226 -8 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788226 21:25695484-25695506 TGTTGGGTACACCTCCCAGACGG 0: 1065
1: 787
2: 161
3: 187
4: 172
1177788220_1177788226 11 Left 1177788220 21:25695450-25695472 CCGCCATCGTCATCATGGCCCGT 0: 363
1: 891
2: 815
3: 196
4: 115
Right 1177788226 21:25695484-25695506 TGTTGGGTACACCTCCCAGACGG 0: 1065
1: 787
2: 161
3: 187
4: 172

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177788226 Original CRISPR TGTTGGGTACACCTCCCAGA CGG Intronic
Too many off-targets to display for this crispr