ID: 1177788228

View in Genome Browser
Species Human (GRCh38)
Location 21:25695486-25695508
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2536
Summary {0: 920, 1: 956, 2: 411, 3: 80, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177788221_1177788228 10 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788228 21:25695486-25695508 TTGGGTACACCTCCCAGACGGGG 0: 920
1: 956
2: 411
3: 80
4: 169
1177788220_1177788228 13 Left 1177788220 21:25695450-25695472 CCGCCATCGTCATCATGGCCCGT 0: 363
1: 891
2: 815
3: 196
4: 115
Right 1177788228 21:25695486-25695508 TTGGGTACACCTCCCAGACGGGG 0: 920
1: 956
2: 411
3: 80
4: 169
1177788223_1177788228 -5 Left 1177788223 21:25695468-25695490 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1177788228 21:25695486-25695508 TTGGGTACACCTCCCAGACGGGG 0: 920
1: 956
2: 411
3: 80
4: 169
1177788225_1177788228 -6 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788228 21:25695486-25695508 TTGGGTACACCTCCCAGACGGGG 0: 920
1: 956
2: 411
3: 80
4: 169

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
Too many off-targets to display for this crispr