ID: 1177788231

View in Genome Browser
Species Human (GRCh38)
Location 21:25695495-25695517
Sequence CCTCCCAGACGGGGCGGCCG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 443
Summary {0: 1, 1: 2, 2: 85, 3: 120, 4: 235}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177788220_1177788231 22 Left 1177788220 21:25695450-25695472 CCGCCATCGTCATCATGGCCCGT 0: 363
1: 891
2: 815
3: 196
4: 115
Right 1177788231 21:25695495-25695517 CCTCCCAGACGGGGCGGCCGCGG 0: 1
1: 2
2: 85
3: 120
4: 235
1177788221_1177788231 19 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788231 21:25695495-25695517 CCTCCCAGACGGGGCGGCCGCGG 0: 1
1: 2
2: 85
3: 120
4: 235
1177788223_1177788231 4 Left 1177788223 21:25695468-25695490 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1177788231 21:25695495-25695517 CCTCCCAGACGGGGCGGCCGCGG 0: 1
1: 2
2: 85
3: 120
4: 235
1177788225_1177788231 3 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788231 21:25695495-25695517 CCTCCCAGACGGGGCGGCCGCGG 0: 1
1: 2
2: 85
3: 120
4: 235

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177788231 Original CRISPR CCTCCCAGACGGGGCGGCCG CGG Intronic
900796579 1:4712042-4712064 CTCCACAGCCGGGGCGGCCGGGG - Exonic
901066641 1:6497458-6497480 CCCCCGAGGCGGGGCCGCCGCGG - Intronic
903163013 1:21502846-21502868 CCTCCCAGACGGGGTCGCGGCGG + Intergenic
903426461 1:23257614-23257636 CTTCTCAGACGGGGCGGCTGCGG - Intergenic
903531238 1:24032192-24032214 CTTCTCAGACGGGGCGGCCGGGG + Intergenic
903652460 1:24930217-24930239 CCGCGGAGTCGGGGCGGCCGCGG - Intronic
903807143 1:26013494-26013516 CCTCCCAGAGGGAGAGGCCCTGG + Intergenic
905108452 1:35577548-35577570 CCTCCCAGCCTGGGCGGGAGCGG + Intronic
905315603 1:37080580-37080602 CTTCTCAGACGGGGCGGCTTCGG - Intergenic
905647252 1:39633191-39633213 CCTCCCACGCGGTGCGGCCGGGG + Intronic
906293004 1:44632052-44632074 CCTCGCCGGCCGGGCGGCCGTGG + Intronic
906308790 1:44738573-44738595 CCTCCCAGACAGGGTGGCGGCGG - Intergenic
906308891 1:44738857-44738879 CCTCCCAGATGGGGTGGCGGCGG - Intergenic
906376951 1:45303775-45303797 CCTTCCAGAGGCGGCGGCCCCGG - Intronic
909622944 1:77686949-77686971 CTTCCCAGACGGTGCGGGCCGGG - Intergenic
910815746 1:91289173-91289195 CCTCCCAGACGGGGTGGTGGCGG + Intronic
912355679 1:109053062-109053084 CTTCCCAGACGGGGTGGCGGCGG - Intergenic
914374673 1:147062245-147062267 CCTCCCAGATGGGGTGGCGGTGG - Intergenic
914451334 1:147794704-147794726 CCTCCCAGACGGCATGTCCGGGG - Intergenic
914468414 1:147950517-147950539 CTTCCCAGACGGGGTGGCGCCGG + Intronic
914787977 1:150851086-150851108 CTTCCCGGACGGGGCGGCTGCGG - Intronic
915572397 1:156751598-156751620 CCGCACGGACGGGGCGGGCGCGG + Intronic
916037443 1:160933629-160933651 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
916049966 1:161029377-161029399 CTTCCTAGACGGGGTGGCGGCGG - Intronic
916050032 1:161029649-161029671 CCTCCCAGACGGGGTGGCGGCGG - Intronic
916223407 1:162466087-162466109 CCTCCCAGACGGGGTTGCGGCGG - Intergenic
918812513 1:189139926-189139948 CCTCCCAGACGGGGTGGCAGCGG + Intergenic
918818828 1:189225852-189225874 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
919423907 1:197405878-197405900 CTTCCCAGACGGGGTGGCTGCGG - Intronic
919925927 1:202191800-202191822 CTTCTCAGACGGGGCGGCCGGGG + Intergenic
920152509 1:203920031-203920053 CTTCTCAGACGGGGCGGCCAGGG + Intergenic
923901081 1:238327101-238327123 CTTCCCAGACGGGGTGGCGGCGG + Intergenic
1063443091 10:6089204-6089226 CCACCCACCCGGGGCCGCCGGGG - Intronic
1064316570 10:14263234-14263256 TCACCCAGACGGGGCTGGCGGGG - Intronic
1065636724 10:27742517-27742539 CCTCCCCGGCGGGGCGCCCGGGG + Intronic
1066026099 10:31362026-31362048 CTTCGCAGACGGGGCGGCGGCGG + Intronic
1066140530 10:32500358-32500380 CCTCCCAGATGGGGTGGTGGCGG + Intronic
1066325360 10:34353066-34353088 CTTCCCAGACAGGGCAGCTGCGG - Intronic
1067026424 10:42847306-42847328 CCTCCCAGACGGGGTCGCGGTGG - Intergenic
1067391306 10:45865871-45865893 CTTCCCAGACTGGGCAGCCCGGG + Intergenic
1067871983 10:49970281-49970303 CTTCCCAGACTGGGCAGCCCGGG - Intronic
1067912069 10:50355918-50355940 CCTCCCAGACAGGGTGGCGGCGG - Intronic
1068536338 10:58244308-58244330 CTTCCCAGACGGGGCGGCCTGGG - Intronic
1070807418 10:79278956-79278978 CCTCCCAGACAGGGTGGTGGCGG + Intronic
1070807538 10:79279275-79279297 CCTCCCAGATGGGGTGGTGGCGG + Intronic
1072180383 10:92975538-92975560 CGTCCCGGACGGGGCGGCTGGGG - Intronic
1073116219 10:101093403-101093425 CCTCCCAGACAGGGCTCCAGGGG - Intronic
1073137314 10:101227193-101227215 CCTCCCGGACCGGACCGCCGAGG - Exonic
1074130384 10:110568159-110568181 GCACCCCGCCGGGGCGGCCGCGG + Intronic
1074152157 10:110767483-110767505 CTTCTCAGACGGGGCGGCTGCGG + Intronic
1075243374 10:120798626-120798648 CCTCCCAGACGGCGTGGCGGCGG - Intergenic
1075778435 10:125002505-125002527 CCTCCCAGAACGGGAGGCCCAGG + Intronic
1075842842 10:125518662-125518684 CCTCCCAGACGGGGTGGTCTGGG - Intergenic
1076011778 10:126994992-126995014 CCTCCCAGACGGGGTGGCGGCGG + Intronic
1076291345 10:129348391-129348413 CCTCCGAGCCGGGGCTGCCACGG + Intergenic
1076750075 10:132538022-132538044 CCTCCGGGACCGGCCGGCCGGGG - Exonic
1076905254 10:133358010-133358032 CCCGGCAGACGGGGCGGGCGGGG + Exonic
1077200473 11:1304536-1304558 GCGCCAGGACGGGGCGGCCGAGG + Intronic
1080045771 11:27806273-27806295 CCGCCCACGCCGGGCGGCCGAGG - Intergenic
1081612709 11:44572597-44572619 TCTCCCAGCCTGGGCGGCTGCGG - Intronic
1082065073 11:47892973-47892995 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
1082065163 11:47893214-47893236 CCTCCCAGACGGGGTCTCGGCGG - Intergenic
1082166475 11:48955838-48955860 CCTCCCAGACGGGGTGGCAGTGG + Intergenic
1083120780 11:60510287-60510309 CCTCCCAGATGGGGTGGCGGTGG - Intergenic
1083391722 11:62356141-62356163 CCTCCCAGACAGGGTGGTGGCGG + Intronic
1083747770 11:64745007-64745029 CCTCCCGGGCGGCGCGGCAGGGG - Intronic
1083888713 11:65585252-65585274 CCGCGCAGACGGGGCGGCCCCGG + Exonic
1085561269 11:77474206-77474228 CCTCCCCGGCGCGGCGGCGGCGG + Intronic
1085791306 11:79499939-79499961 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
1086434828 11:86770736-86770758 CTTCCCAGACGGGGCGGCTGCGG + Intergenic
1087198364 11:95321426-95321448 CATCCCAGATGGGGCTGGCGGGG + Intergenic
1089374617 11:117985896-117985918 ACCCCCAGACGGGGAGGCCCTGG + Intergenic
1090190287 11:124762372-124762394 CCTCCCGGGCGGGGCGCGCGGGG + Intergenic
1090750627 11:129743691-129743713 CCACCCAGACTGGGCTGCGGCGG + Intergenic
1090762208 11:129847904-129847926 CCTCCCAGATGGGGTGGTGGTGG + Intronic
1091848551 12:3677106-3677128 CCTCCCAGGAGGGGTGGCCTTGG - Intronic
1092850015 12:12618342-12618364 CCTCCTAGACGGGGTGGCGGTGG + Intronic
1093431673 12:19092180-19092202 CCTCCCAGATGGGGCGGACATGG - Intergenic
1093685052 12:22046120-22046142 GGCCCCAGACGAGGCGGCCGCGG + Intergenic
1094025885 12:25959096-25959118 CCGCCCAGAGGGGCCGGCCGGGG - Exonic
1095113925 12:38330625-38330647 CCTCCCAGACGGGGTCGCGCTGG + Intergenic
1095452819 12:42350161-42350183 CCTCCCAGACCGGGCGGCTGGGG + Intronic
1096044597 12:48551726-48551748 CTTCCCAGACTGGGCAGCCAGGG - Intergenic
1096968684 12:55648470-55648492 CCTCCCAGACGGGGTGGCGGTGG + Intergenic
1097138566 12:56879616-56879638 CCTCCCAGACGGGGTGGCTGTGG - Intergenic
1097732998 12:63150889-63150911 CCTCCGAGACGGGGAGGGAGCGG - Exonic
1097929828 12:65170595-65170617 CCTCGAAGAGGCGGCGGCCGCGG + Exonic
1098021517 12:66160986-66161008 CTTCCCAGACCGGGCAGCGGCGG + Intronic
1098333146 12:69375214-69375236 CCTCCCAGACGGGGTGGCGGCGG + Intronic
1099971367 12:89503920-89503942 CTTCCCAGACAGGGTGGCTGCGG - Intronic
1100048210 12:90411138-90411160 CCTCCCAGGCGGGGTGGCGGCGG - Intergenic
1100315444 12:93441389-93441411 CCGCCCCGACGGGGCCGCGGAGG - Intronic
1101144788 12:101830845-101830867 GCTCCCGGAAGCGGCGGCCGCGG - Exonic
1101393335 12:104323363-104323385 CTTCCCAGTAGGGGCGGCCGGGG + Intronic
1102186351 12:110951051-110951073 CTTCCCAGACGGGGTGGCAGCGG + Intergenic
1102323297 12:111957312-111957334 CCTCCCAGACGGGGTGGCGGCGG - Intronic
1102656307 12:114485005-114485027 CCTCCCAGACGGGGTCGTGGCGG + Intergenic
1105248469 13:18673928-18673950 CTTCTCAGACGGGGCGGTTGCGG - Intergenic
1105702044 13:22940997-22941019 CCACTCAGACGTGGTGGCCGTGG + Intergenic
1106560242 13:30839920-30839942 CTTCTCAGACGGGGCGGCCAGGG + Intergenic
1106799493 13:33242108-33242130 CCTTCCAGATGGGGTGGCGGCGG - Intronic
1108059102 13:46515414-46515436 CCTCCCAGACGGGGTGGTGGCGG + Intergenic
1108685868 13:52818156-52818178 TCTCCCAGACGGGGTGGCGGTGG - Intergenic
1110506668 13:76295218-76295240 CCTCCCAGACGGGGTGGCGGTGG - Intergenic
1111388645 13:87561898-87561920 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
1112070562 13:95845728-95845750 CTTCCCAGACGGGGTGGCGGCGG + Intronic
1112077296 13:95928506-95928528 CCTCTCAGACGGGGTGGTGGCGG + Intronic
1113787557 13:113010553-113010575 CCTCCCAGGTGGGGCTGCTGTGG + Intronic
1114137264 14:19866513-19866535 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
1114336606 14:21697701-21697723 CTTCCTAGACGGGGTGGCGGCGG - Intergenic
1117010652 14:51467639-51467661 CCTCCCAGATGGGGTGGTGGCGG + Intergenic
1117302178 14:54440982-54441004 CCTACTGGATGGGGCGGCCGCGG - Intronic
1118517725 14:66545965-66545987 CTTCTCAGACGGGGCGGCTTCGG + Intronic
1119431030 14:74568022-74568044 CCACCCAGACTGGGGGGCAGGGG + Intronic
1120193795 14:81462567-81462589 CCTCCCAGATGGGGTGGCGGTGG + Intergenic
1122688405 14:103520726-103520748 CCGCCAACACGGGGCGGGCGGGG + Intronic
1122843517 14:104478004-104478026 CCACTCAGAGGCGGCGGCCGTGG + Intronic
1122917623 14:104866067-104866089 CCTTCCGGCCGGGGCGGCTGAGG + Intronic
1123414225 15:20083364-20083386 CTTCCCAGAGGAGGCGGCCATGG + Intergenic
1123523567 15:21090475-21090497 CTTCCCAGAGGAGGCGGCCATGG + Intergenic
1124607868 15:31184650-31184672 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
1126210721 15:46098110-46098132 CCTCCCAGACGGGGTGGCGGCGG + Intergenic
1126573167 15:50172827-50172849 CCTCCCAGACGGGGTGGTGGCGG - Intronic
1126816539 15:52459958-52459980 CCTCCCAGACGGGGTGGCGGCGG + Intronic
1128556907 15:68638076-68638098 CCTCCCAGATGGGGAGGGCCCGG - Intronic
1128587211 15:68860448-68860470 CTTCTCAGACGGGGCGGCCGGGG + Intronic
1128783685 15:70379414-70379436 CCTCACTGACGGTGCAGCCGCGG + Intergenic
1128843731 15:70871707-70871729 CCTCCCAGACGGGGTGGTGGTGG + Intronic
1128970117 15:72100644-72100666 CCTCCCAGACGGGGTCGTGGCGG - Intronic
1129812366 15:78520982-78521004 CCTCCCGGACGGGGCGGCTGAGG + Intronic
1130071110 15:80647561-80647583 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
1130370889 15:83284594-83284616 CCGCCGAGCCGGGGCGGACGCGG - Exonic
1130942687 15:88524200-88524222 CCTCCCAGACGGGCTGGCGGTGG - Intronic
1131510119 15:93045072-93045094 CCTGCCAGGCAGGGCGGCTGCGG - Exonic
1132661557 16:1063611-1063633 CCCCCCATACTGGGCGGCAGCGG + Intergenic
1132904968 16:2277845-2277867 CCACCCAGTGGGGGCTGCCGGGG + Intronic
1132925018 16:2424779-2424801 CCACCCAGTGGGGGCTGCCGGGG - Intergenic
1134172062 16:11976689-11976711 CTTCCGGGGCGGGGCGGCCGGGG + Intergenic
1136365374 16:29806908-29806930 CCCCCCAGCCCGGGCCGCCGCGG - Intronic
1137244946 16:46694597-46694619 CTTCCCAGTAGGGGCGGCCGGGG + Intronic
1137439119 16:48483354-48483376 CATCCCAGACGGGGCGGCGGGGG + Intergenic
1137926724 16:52547329-52547351 CCCCGGAGAGGGGGCGGCCGCGG - Intronic
1138037709 16:53625325-53625347 CCACCCAGATGGGGCAGCCGCGG - Intronic
1140602923 16:76500077-76500099 CCTCCCTGACGGGGTGGCGGCGG + Intronic
1141538630 16:84700439-84700461 CCTCCCCGCCGCGCCGGCCGGGG + Intronic
1141715662 16:85725359-85725381 CCTTCCAGATGGGGCTGCGGTGG - Intronic
1141720195 16:85751425-85751447 CCTCCCATACTGGGGGGCCCGGG + Intergenic
1141961275 16:87411097-87411119 CCTCCCTGCCGGCGCGGCTGTGG - Intronic
1141979589 16:87541632-87541654 ACTCCCAGACGGCGGGGCCTAGG + Intergenic
1142413992 16:89931472-89931494 GCTCCCAGACGCAGCGGCCTCGG + Intronic
1142440945 16:90097164-90097186 CCTCCCTGCCAGGGCGGCAGAGG - Intergenic
1142619177 17:1154192-1154214 TCTCCCAGAAGTGGCAGCCGCGG - Intronic
1142762470 17:2050385-2050407 GCCCCCAGCCGGGGCAGCCGGGG - Intergenic
1143018734 17:3905246-3905268 CATCCCAGACCTGGGGGCCGAGG + Exonic
1143115293 17:4578493-4578515 CCTCCCGGATGGGGTGGCTGCGG + Intergenic
1143503450 17:7351750-7351772 CCTTCCAGCCGGGGTGGCCCGGG - Intergenic
1143639303 17:8186554-8186576 CTGTCCAGACGGGGCGGCCTTGG - Intergenic
1144541320 17:16145543-16145565 CCTCCCAGACAGGGTGGCGGCGG - Intronic
1145007253 17:19344709-19344731 CCTCAGAGACGGAGAGGCCGCGG - Intronic
1145969595 17:28949393-28949415 GATCCCAGACGGGGCCCCCGAGG + Intronic
1147150341 17:38510474-38510496 CCGCCCAGACGGCGAGGGCGCGG + Exonic
1147277876 17:39333829-39333851 CCTCCCAGACGGGGTGGCGGCGG - Intronic
1148086309 17:44995758-44995780 CCTCCCAACCCGGGAGGCCGGGG - Intergenic
1149585386 17:57782830-57782852 CCTCGCAGAAGGGGCGGAGGAGG + Intergenic
1150518281 17:65837487-65837509 CCTCCCAGACGGGGTGGCAGCGG - Intronic
1152672693 17:81618418-81618440 CTTCCCAGACGGGGCGGCTGCGG - Intronic
1152696226 17:81798097-81798119 CTTCTCAGACGGGGCGGCTGCGG + Intergenic
1152815782 17:82406925-82406947 CCTCCCAGACCGGCCAGACGTGG + Intronic
1154116156 18:11614271-11614293 CCTCCCAGACGGGGCAGCCAGGG - Intergenic
1154420545 18:14224029-14224051 CTTCCCAGATGGGGTGGCCAGGG - Intergenic
1154420649 18:14224366-14224388 CTTCCCAGATGGGGTGGCCAGGG - Intergenic
1157857750 18:51117393-51117415 CCTCCCAGACGGGGTGGTGGTGG + Intergenic
1158646886 18:59255663-59255685 CCTCCCAGACGGGGTGGCAGCGG - Intergenic
1160453324 18:78979716-78979738 CCTCCCGGAGCGAGCGGCCGCGG - Intergenic
1160680120 19:408533-408555 CCGCCCAGGCGCGGCGGCCCAGG + Intronic
1160972749 19:1776670-1776692 CCTCCGAGACTGGCCGGCCGCGG + Exonic
1161975628 19:7606538-7606560 CCCTGCAGACGGGGCGGCCCCGG + Exonic
1162024707 19:7887507-7887529 CCTCCCAAGTGGGGCGGCCAGGG + Intergenic
1162542037 19:11302954-11302976 CCTCCCGGACGGGGCGGCTGAGG - Intronic
1162542065 19:11303031-11303053 CCTCCCAGACGGGGTGGTGGCGG - Intronic
1162867324 19:13558234-13558256 CTTCCCAGATGGGGCGACCGGGG - Intronic
1162939105 19:13997409-13997431 CCTACCAGGCGGGGCTGCTGAGG + Intronic
1163865530 19:19770176-19770198 CCTCCCAGATGGGGTGGCGGCGG - Intergenic
1164017466 19:21265281-21265303 CTTCCCAGACAGGGCGGGGGTGG - Intronic
1164659299 19:29949143-29949165 CCTCCCAGATGGGGCGGCTGTGG + Intronic
1165540740 19:36490883-36490905 CTTCCCAGATGGGGTGGCGGCGG - Intergenic
1165992850 19:39826057-39826079 CCTCCCAGCCGCTGCGGCCCTGG - Exonic
1166418063 19:42610622-42610644 CGTCCCAGACGGGGTCGCGGTGG + Intronic
1166611678 19:44204013-44204035 CCTCCCAGACAGGGTGGCAGCGG - Intergenic
924981296 2:223884-223906 GCTCCCAGAAGGGGAGGCCAGGG + Intronic
926075370 2:9938388-9938410 TCTCCCAGCCGGGGCAGCCCGGG - Intergenic
927472272 2:23385401-23385423 CCCCGCAGCCGCGGCGGCCGCGG - Exonic
927684423 2:25160979-25161001 CCTCCCAGCCTGGGGGGTCGTGG - Exonic
927904700 2:26848231-26848253 CCTCCGAGATGCTGCGGCCGCGG - Exonic
928687179 2:33761462-33761484 CTTCCCAGACGGGGCGGCTGCGG + Intergenic
929066123 2:37977632-37977654 CCTCCCAGACGGGGTGCCAGTGG + Intronic
929614799 2:43298032-43298054 CTTCCCAGTAGGGGCGGCCGGGG - Intronic
930363583 2:50411594-50411616 CCTCCCAGAAGGGGTGGCGGTGG - Intronic
930665579 2:54096067-54096089 CCTCCCGGACGGGGTGGCTGCGG + Intronic
932253822 2:70267100-70267122 CCTCCCAGACGGGATGGCGGCGG + Intronic
934128346 2:88920601-88920623 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
934703460 2:96461633-96461655 CTTCCCAGATGGGGTGGCTGCGG - Intergenic
936104832 2:109614840-109614862 GCTCCCCGACGCGGCGGCCCCGG + Exonic
937279860 2:120710366-120710388 CCTCCCAGAGGGGCCGGAGGTGG - Intergenic
941822381 2:169856144-169856166 CCTCCCAGACGGGGTGGCGGCGG + Intronic
941847765 2:170149839-170149861 CTTCTCAGACGGGGCGGCCGGGG - Intergenic
942112921 2:172700352-172700374 CCTCCTGGACGGGGTGGCGGCGG + Intergenic
943411697 2:187556584-187556606 CCTCCCAGACGGGGTCGCGGCGG - Intronic
943863188 2:192894176-192894198 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
944570803 2:201042524-201042546 CCTCCCAGACGGGGTGGCGGCGG - Intronic
944585160 2:201166395-201166417 CTTCTCAGACGGGGCAGCTGCGG + Exonic
944751465 2:202715052-202715074 CCTCCCAGACGGGGTGGTGGCGG + Intronic
945530854 2:210950987-210951009 CCTCCTGGATGGGGCGGCGGCGG - Intergenic
948771163 2:240251856-240251878 GCTCCCAGATGGGGAGGCAGTGG - Intergenic
948941478 2:241199108-241199130 ACTCCCAAACGGGGCTGTCGAGG + Intronic
1169038164 20:2470548-2470570 CCGCCCAGACCGAGCGGCCTCGG + Intronic
1169274110 20:4221585-4221607 CGTCCCACACGAGGTGGCCGAGG - Exonic
1171011341 20:21510896-21510918 CCTCTCGGGCGGGGAGGCCGGGG - Intergenic
1173864949 20:46307772-46307794 CCTCCCAGAGGCGGGGTCCGGGG - Intronic
1176852709 21:13935175-13935197 CTTCCCAGATGGGGCAGCCGGGG + Intergenic
1177788231 21:25695495-25695517 CCTCCCAGACGGGGCGGCCGCGG + Intronic
1179950474 21:44706613-44706635 CTTCTCAGAGGGGGCGGCCGAGG + Intronic
1181087705 22:20449949-20449971 CCTCCGGGCCGGGGCGGCGGCGG + Intronic
1182545894 22:31076204-31076226 CTTCCCAGAGGAGGCGGCCACGG - Intronic
1182982463 22:34684589-34684611 CCTCCCAGACTGGGTCGCGGCGG + Intergenic
1183350951 22:37334635-37334657 GCGCCCAGGCGGGGCCGCCGCGG - Intergenic
1183370100 22:37427331-37427353 CCTCCGGGAAGCGGCGGCCGCGG + Exonic
1184265249 22:43342986-43343008 CCCCGCAGCCCGGGCGGCCGGGG - Intronic
1184552251 22:45210631-45210653 ACACCCAGACAGGGCGGGCGTGG + Intronic
1185047645 22:48537076-48537098 CCTGCCAGACCGGGAGGCCGAGG - Intronic
1185388888 22:50548510-50548532 CCTCGCAGAGGAGGAGGCCGCGG - Exonic
949989895 3:9570130-9570152 CCTCCCGGACGGGGCGGCTGCGG - Intergenic
950742538 3:15062326-15062348 CTTCCCAGTAGGGGCGGCCCGGG - Intronic
951264195 3:20547967-20547989 CCTCTCAGACCGGGTGGCTGTGG + Intergenic
952894012 3:38064650-38064672 CCTCCCGGACGGGGTGGCTGCGG + Intronic
953440173 3:42909780-42909802 CCTCCCAGATGGCGTGGCGGCGG + Intronic
953709678 3:45259633-45259655 CCTCCCAGAAGGGGCTCCAGGGG - Intergenic
954399654 3:50312303-50312325 CTTCTCAGACGGGGCGGCCAGGG + Intronic
954567043 3:51607981-51608003 CCTCCCGGGCGGGGCAGCTGCGG + Intronic
954567088 3:51608138-51608160 CCTCCCAGACGAGGTGGCGGCGG + Intronic
956279407 3:67540591-67540613 CCTGCCAGAAGGGGCGGCTGTGG + Intronic
956803826 3:72788358-72788380 CCTCCCAGATGGGGTGGCGGCGG - Intronic
958692041 3:97481059-97481081 CTTCCCAGACGGGGTGGCAGCGG + Intronic
959042520 3:101438944-101438966 CTTCCCAGACGGGGTGGCACCGG - Intronic
959201690 3:103255055-103255077 CTTCCCAGACGGGGTGGCTGCGG + Intergenic
959530419 3:107429916-107429938 CCTCCCAGCCTGGGCGCCTGGGG - Intergenic
960223737 3:115146926-115146948 CCTCCCCGCCGGGTCGGGCGAGG + Intronic
960344875 3:116519280-116519302 CCTCCCAGACGGGGTAGCGGCGG - Intronic
960577483 3:119242648-119242670 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
960638940 3:119809500-119809522 CCTTCCAGACTGGGCGGCCAGGG - Intronic
960770797 3:121190851-121190873 CCTCCCAGACGGGGTGGCGGCGG + Intronic
960817467 3:121688598-121688620 CTTCCCAGACGGGGTGGCGGCGG - Intronic
961163988 3:124750931-124750953 CTTCCCAGACGGGGTGGCGGCGG + Intergenic
961539697 3:127591088-127591110 CCGCCCCGACGGTCCGGCCGCGG - Intronic
961674302 3:128555497-128555519 GCTTCCTGGCGGGGCGGCCGCGG - Intergenic
962787927 3:138785035-138785057 CTTCCCAGACGGGGCGGCTGCGG - Intronic
963249068 3:143086742-143086764 CCTCCCGGACGGGGTGGCTGCGG + Intergenic
966350986 3:179032686-179032708 CCTCCCAGATGGGGTGGTGGTGG - Intronic
966351006 3:179032763-179032785 CTTCCCAGACGGGGCGGCTGCGG - Intronic
966696426 3:182793973-182793995 CCTCCAAGCCCGGGCCGCCGAGG + Intronic
966777077 3:183552426-183552448 CCTCACAGACTGGTCGGGCGCGG + Intronic
966883280 3:184361653-184361675 CCTCCCCGGCGGGCGGGCCGAGG + Intronic
967127204 3:186435354-186435376 CATCACAGACGGGGTGGCGGTGG + Intergenic
967127260 3:186435512-186435534 CCTCCCAGACGGGGTGGCGGCGG + Intergenic
967177692 3:186874497-186874519 CTTCCCAGTAGGGGCGGCCGGGG - Intergenic
968156517 3:196385610-196385632 CCTCCCAGAGTGGGTGGCGGCGG - Intronic
968361206 3:198148151-198148173 CCTCCCTGCCAGGGCGGCAGAGG - Intergenic
968521735 4:1037339-1037361 CCCTCCAGGCTGGGCGGCCGAGG - Intergenic
968652874 4:1767077-1767099 TCTCCCAGTCGGGGCCGCAGGGG - Intergenic
968852831 4:3094838-3094860 CCTCCCAGACGGGGTGGCAGTGG + Intronic
969384782 4:6837262-6837284 CCTCCCAGACGGGTTGGCGGCGG + Intronic
969471704 4:7392889-7392911 CCTCCCAGTCGGGGGGGGGGGGG + Intronic
970004734 4:11399756-11399778 GCACCCCGACGTGGCGGCCGCGG - Exonic
972396654 4:38664099-38664121 CCGCCCAGCCCGGGCGGCCGCGG + Intergenic
973664079 4:53139447-53139469 CCTCCCAGACGGGGTGGCGGCGG - Intronic
974597848 4:64037288-64037310 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
975795944 4:78007238-78007260 CTTCCCAGACAGGGCGGCTGCGG + Intergenic
976149438 4:82077919-82077941 CCTCCTGGAGGGGGCGGCTGCGG - Intergenic
976246492 4:83010850-83010872 CCTCCCGGGTGGGGCGGGCGGGG - Intronic
978224893 4:106321430-106321452 CCTCCCAGACGGGGTGGCGGCGG - Exonic
978888708 4:113796553-113796575 CCTCCCAGACGGGGGTGGCCGGG - Intergenic
978888757 4:113796709-113796731 CCTCCCAGACGGGGTGGTGCTGG - Intergenic
978947540 4:114516703-114516725 CCTCCCGGACAGGGTGGCTGCGG - Intergenic
979273703 4:118792170-118792192 CCTCCCAGACGGGGTGGCGGCGG - Intronic
979641396 4:123015781-123015803 CCTCCCGGACCGGGCGGCTCGGG + Intronic
979941760 4:126771287-126771309 CCTCCCAGACGGGGTGGCGGTGG - Intergenic
980075146 4:128287229-128287251 CGTCCCAGGTGCGGCGGCCGAGG + Intronic
982723445 4:158882069-158882091 CCTCCCAGACAGGGTTGCGGTGG - Intronic
983919830 4:173333872-173333894 CCTCCCGGCCCGAGCGGCCGCGG + Intronic
984004986 4:174295338-174295360 CATCCCAGACGGGGCGGCAGGGG + Intronic
984156734 4:176203653-176203675 CCTCCTAGACGGCGCAGCCCAGG - Intergenic
985548375 5:521083-521105 CCTCCCAGACTGAGAGGACGAGG - Intronic
989061475 5:37415476-37415498 CCTCCCGGAAGGGGCGGCTGGGG + Intronic
989372284 5:40722667-40722689 CTTCCCAGACTGGGCGGCTGTGG - Intronic
989574733 5:42979379-42979401 CCTCCCAGACGGCGTGGCGTTGG - Intergenic
989648785 5:43665904-43665926 CTTCCCGGACGGGGTGGCGGCGG + Intronic
989655929 5:43746286-43746308 CCTCCCAGACGGGGTGGCAGTGG + Intergenic
992415801 5:76551080-76551102 CTTCCCAGACGGGGCGGCTGCGG + Intronic
993723370 5:91343115-91343137 CCTCCCAGACAGGGTGGCGGTGG + Intergenic
993934603 5:93985835-93985857 CTTCCCAGACGGGGTGGCGGCGG - Intronic
995456826 5:112360918-112360940 CCTCCCAGACGGAGTGGCGGCGG - Intronic
996057674 5:118999062-118999084 CCTCCCAGATGGGGTGGCGGCGG - Intergenic
996551507 5:124735377-124735399 CGTTCCCGACGGGGCGGCGGGGG - Intronic
997335866 5:133108816-133108838 CCTCCCGGACGGGGCGGCTGAGG - Intergenic
999455631 5:151714040-151714062 CCTCCCGGACGGGGCGGCTGCGG + Intergenic
999455738 5:151714429-151714451 CTTCCCAGACGGGGTGGCGGCGG + Intergenic
1001402904 5:171456639-171456661 TCACCAAGAAGGGGCGGCCGCGG + Exonic
1001717122 5:173825372-173825394 CTCACCAGACGGGGCAGCCGGGG - Intergenic
1001929114 5:175660076-175660098 CCTCCCAGGCGATGCGTCCGTGG + Intronic
1002405054 5:179024008-179024030 CGTCCGAGCCGGGGCGGCCTCGG + Intronic
1004664170 6:17735483-17735505 CTTCCCAGTAGGGGCGGCCGGGG + Intergenic
1005624874 6:27653586-27653608 CCTCCCAGACGGGGTGGTGGTGG - Intergenic
1005710861 6:28502238-28502260 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
1005860403 6:29895979-29896001 CCTCTCAGACGGGGCGGCCGGGG + Intergenic
1006128512 6:31854521-31854543 CTTCCCAGATGGGGTGGCTGCGG + Intergenic
1006225344 6:32532227-32532249 CATCCCAGACGGGGTGGCAGCGG - Intergenic
1006225354 6:32532265-32532287 CTTCTCAGACTGGGCGGCCGGGG - Intergenic
1006281690 6:33059470-33059492 CCTCCCAGACGGGGTGGTGGCGG + Intergenic
1006826928 6:36941949-36941971 CCTCCCAGAAGGGGTGGCGGCGG - Intergenic
1007469669 6:42080624-42080646 CCACCCACACTGGGAGGCCGAGG - Exonic
1008919253 6:56824847-56824869 CCTCCCGGACGGGGTGGCTGCGG - Intronic
1009042020 6:58190717-58190739 CCTCCCAGACGGGGTGGTGGTGG - Intergenic
1009217871 6:60944982-60945004 CTTCCCAGACGGGGTGGCGGCGG - Intergenic
1010400590 6:75441948-75441970 CCTCCCGGACGGGGTGGCTGCGG + Intronic
1010788291 6:80031003-80031025 CCTCCCAGACTGGACTGCAGTGG - Intronic
1010926830 6:81753914-81753936 CCTCCCAGTCTGGGCGGGCAGGG - Intergenic
1012899518 6:104991080-104991102 CCTCCCAGACGGGGTGGCGGCGG + Intronic
1013204473 6:107934133-107934155 CTTCCCAGACGGGGTGGCGGCGG - Intronic
1013206944 6:107953901-107953923 CGTCCCAGTAGGGGCGGCTGAGG - Intronic
1013514848 6:110875763-110875785 CCTCCCACCCGCGGCGGCCGCGG + Intronic
1013800099 6:113932154-113932176 CCTCCCAGATGGGGTGGCGGCGG - Intergenic
1014463688 6:121729830-121729852 CCTCCCAGACGGGGTGGCAGCGG + Intergenic
1015252826 6:131144281-131144303 CCTCCCAGACGGGGTCGTGGCGG + Intronic
1015750030 6:136550223-136550245 CCTCCCCGCCCGCGCGGCCGCGG - Intronic
1016010811 6:139135701-139135723 CCTCCCCGACGGGGACGGCGCGG + Intronic
1016936177 6:149450907-149450929 CCGCCCAGACGGAGCGCCCAGGG + Exonic
1017063424 6:150507459-150507481 CTTCCCAGATGGGGTGGCCGCGG - Intergenic
1017215273 6:151899979-151900001 CTTCCCAGACGGGGTGGCCCCGG + Intronic
1017971509 6:159315855-159315877 CCTCTCCCACGGGGAGGCCGGGG + Intergenic
1018890445 6:167977870-167977892 CCTCCCACCCGGGGCCTCCGCGG + Intergenic
1019254482 7:40570-40592 CCTCCCTGCCAGGGCGGCAGAGG + Intergenic
1019354471 7:571595-571617 CCTCCTATACGGGGCGGCAGCGG - Intronic
1019400533 7:849982-850004 CCTGCCCGACCGGGCAGCCGTGG - Intronic
1019451883 7:1103104-1103126 CCTCCCGGACGGGGCTGCCAGGG - Intronic
1019518866 7:1451701-1451723 CCTCCCAGACAGGGAGACTGAGG - Intronic
1019651525 7:2161789-2161811 CCTCCCAGACGGGGTGGCGGTGG - Intronic
1020938868 7:14505412-14505434 TCTCCCAGACTGGGCTGCAGTGG - Intronic
1022005398 7:26262065-26262087 CTTCTCAGACGGGGCGGCTGTGG - Intergenic
1022096037 7:27142360-27142382 CCTCCCGATCGGGGCGCCCGGGG - Intronic
1022663600 7:32387872-32387894 CCTCCCGGACGGGGCGGCTGAGG + Intergenic
1022757168 7:33304533-33304555 CTTCCCAGACAGGGCAGCCGAGG - Intronic
1023954254 7:44871880-44871902 CCTCCCAGACGGGGCGGCCAGGG + Intergenic
1024034357 7:45495079-45495101 CCTGCCAGGAGGGGCGGCCGTGG - Intergenic
1024305117 7:47922595-47922617 CCTCCCAGACGGGGTGGCGGCGG - Intronic
1024639323 7:51316743-51316765 CCTCCCACGCGGGCCGGCGGAGG + Exonic
1025015116 7:55433150-55433172 CCTCTCAGACGAGGAGGCAGCGG + Exonic
1025852940 7:65258450-65258472 CTTCCCAGTAGGGGCGGCCGGGG - Intergenic
1026008025 7:66614796-66614818 CCTCCCGGAAGGGGTGGCTGCGG - Intergenic
1026923757 7:74174602-74174624 GCTCGGAGACGGGGCGGCGGCGG + Intronic
1028790538 7:94849179-94849201 CTTCCCAGACGGTGTGGCGGTGG + Intergenic
1028790626 7:94849538-94849560 CTTCCCAGACGGTGGGGCGGCGG + Intergenic
1029371728 7:100154898-100154920 CCTCCCAGACGGGGGTGAAGAGG - Exonic
1032013482 7:128361349-128361371 CCTCCGAAAAGGGGCGGTCGTGG + Exonic
1033219756 7:139520289-139520311 CTTCTCAGACGGGGCGGCCGGGG + Intergenic
1033376060 7:140763167-140763189 CTTCCCAGTAGGGGCGGCCGGGG + Intronic
1034430926 7:151040831-151040853 CCTCGAAGCCGGGGCGGCAGGGG - Exonic
1035182148 7:157097297-157097319 CTTCCCAGACGGGCTGGCCAGGG - Intergenic
1035954561 8:4061979-4062001 CCTCTCAGACAGGGCAGCAGGGG - Intronic
1036121288 8:6020452-6020474 CATCCCAGACGGGGCTGCAAAGG + Intergenic
1036786645 8:11692561-11692583 CCTCCCAGGCGGAGCCGCCGCGG - Intronic
1036930460 8:12951505-12951527 CGTCCCCGGCGGGGCGGGCGCGG + Intronic
1037836648 8:22218681-22218703 CCTCCCACATGGGGCGTCCTAGG - Intergenic
1038004492 8:23418165-23418187 CCTTCCAGACGGGATGACCGAGG + Intronic
1038727563 8:30095256-30095278 TCCCCCAGTCGGGGCGGCGGCGG + Intergenic
1039201031 8:35094386-35094408 CCTCCCAGACGGGGTCGCGGCGG + Intergenic
1039650998 8:39339599-39339621 CTTCCCAGACGGGATGGCGGCGG + Intergenic
1039897294 8:41725415-41725437 CCTCCACTACGGGGCAGCCGGGG + Intronic
1040041365 8:42919294-42919316 CCTCCCAGACGGGGTGGCGGCGG + Intronic
1040052797 8:43033040-43033062 CCTCCCGGGCGGGGCGGCTGGGG + Intronic
1040563452 8:48545291-48545313 CCTGCAAGACAAGGCGGCCGGGG - Intergenic
1041066245 8:54085662-54085684 CCTCCCGGACGGGGTGACGGCGG - Intronic
1041851088 8:62394650-62394672 CTTCCCAGACCTGGCGGCAGCGG + Intronic
1041851190 8:62395129-62395151 CTTCCCAGACGGGGCGGCGACGG + Intronic
1042048933 8:64685666-64685688 CTTCTCAGACGGGGCAGCTGCGG - Intronic
1042912812 8:73844831-73844853 CCTCCCAGACGGGGTGGCGGCGG - Intronic
1045023590 8:98064809-98064831 CCTGCCAGGCGGGGTGGCCACGG - Intronic
1045235710 8:100351170-100351192 CTTCCCAGACGGGGTGGCGGCGG - Intronic
1046599255 8:116297739-116297761 CCTCCCAGACGGGGTGGCGGCGG - Intergenic
1046736040 8:117777713-117777735 CCTCCCAGACCGGGTGGCGGCGG - Intergenic
1046736072 8:117777830-117777852 CTTCCCAGGCCGGGCGGCTGCGG - Intergenic
1047394315 8:124480707-124480729 CTTCCCAGAAGTGGCGGCTGGGG + Intronic
1049380736 8:142314558-142314580 ACTCCCAGAAGAGGCTGCCGGGG + Intronic
1049726444 8:144148495-144148517 CCCCCCAGGCGGGGCCACCGGGG + Intronic
1050417829 9:5434137-5434159 CTTCCCAGACGGGGTGGCGGCGG - Intronic
1050534964 9:6623090-6623112 CCTCCCAGACGGGGTGGTGGCGG - Intronic
1052236121 9:26214856-26214878 CTTCCCAGACGGGGCGGCTGCGG + Intergenic
1052492892 9:29189443-29189465 CCTCCCAGACGGGGTCGCGCCGG + Intergenic
1053048209 9:34937084-34937106 CTTCCCAGTAGGGGCGGCCGGGG - Intergenic
1053569432 9:39288487-39288509 CCACCGGGGCGGGGCGGCCGCGG + Intergenic
1053835393 9:42129508-42129530 CCACCGGGGCGGGGCGGCCGCGG + Intronic
1054091061 9:60847471-60847493 CCACCGGGGCGGGGCGGCCGTGG + Intergenic
1054112472 9:61123027-61123049 CCACCGGGGCGGGGCGGCCGTGG + Intergenic
1054127714 9:61330523-61330545 CCACCGGGGCGGGGCGGCCGCGG - Intergenic
1054595233 9:67059102-67059124 CCACCGGGGCGGGGCGGCCGCGG - Intergenic
1056169641 9:83971936-83971958 CCTCCCGGACGAGGCGGCCGGGG - Exonic
1057488560 9:95505894-95505916 CCTCCCCAGCGCGGCGGCCGCGG + Intronic
1057545975 9:96020926-96020948 CCTCCAAGACGCGCGGGCCGGGG + Intergenic
1060041498 9:120304983-120305005 CCTCCCAGACGGGGTTGTGGCGG - Intergenic
1061037690 9:128122630-128122652 CGTCCCAGACGGGGAGGCTGTGG + Intronic
1061387932 9:130301436-130301458 CCTCCCAGACCTGGAGGGCGGGG - Intronic
1061427233 9:130506939-130506961 CTTCCCAGACGGGGTGGCGGCGG + Intergenic
1061977278 9:134075803-134075825 CCTCCCAGACGGGGTGGCGGTGG - Intergenic
1062502639 9:136857957-136857979 CCTGCCAGCAGGGGCGGCCCAGG - Exonic
1062578808 9:137220908-137220930 CTTCCCTTACGGGGCCGCCGTGG + Exonic
1062582941 9:137236439-137236461 CCTCCCAGCCGGGGAGGGTGGGG - Exonic
1062745917 9:138211983-138212005 CCTCCCTGCCAGGGCGGCAGAGG - Intergenic
1187826106 X:23334543-23334565 CCCCCCTGGCGGGGAGGCCGCGG + Exonic
1189056840 X:37707361-37707383 CTTCCCAGACGGGGTGGCTGCGG + Intronic
1189882048 X:45503853-45503875 CCTCCCAGAAGGGGTGGCCGGGG + Intergenic
1189968649 X:46396387-46396409 CCTCCCAGATGGGGTCGCGGCGG + Intergenic
1190159027 X:48016988-48017010 CCTCCCAGACGGGGTGGCGGCGG - Intronic
1190505268 X:51119725-51119747 CCTCCCAGACAGGGTGGTGGTGG + Intergenic
1190799325 X:53772873-53772895 CCTCCCGGACGGGGCGGCCTGGG + Intergenic
1190906797 X:54736480-54736502 CCTCCCAGACGGGGTGGCGGTGG - Intergenic
1191679375 X:63825630-63825652 CCTCCCAGATGGGGTGGCGGTGG + Intergenic
1191894144 X:65975228-65975250 CCTCCCAGACGGGGTGGCGGCGG + Intergenic
1192252122 X:69422080-69422102 CCTCCCAGACAGGGTGGCAGTGG - Intergenic
1192324811 X:70123125-70123147 CCTCCCAGACGGGGTGGCAGCGG - Intergenic
1192500177 X:71645256-71645278 CCTCCCAGACGGGGTGGCGGCGG + Intergenic
1192664181 X:73069925-73069947 CTTCCCAGACAGGGCGGCCGGGG - Intergenic
1193114841 X:77766375-77766397 CTTCCCAGACGGGGTGGCAGCGG + Intronic
1193890027 X:87033350-87033372 CCTCCCAGACGGGGTGGCGGTGG + Intergenic
1195888943 X:109671309-109671331 TCTCCCAGACGGGGCGGCGGCGG - Intronic
1195979010 X:110558614-110558636 CATCCCAGATGGGGCGGCGGCGG + Intergenic
1197754472 X:129984231-129984253 CCGCCCAGAAGCGGCGGCGGCGG - Intronic
1198108659 X:133483962-133483984 CCTCCCAGACGGGTTGGCGGCGG + Intergenic
1198189170 X:134286138-134286160 CCTCCCAGACGGGGTGGCAGTGG + Intergenic
1199836779 X:151599576-151599598 CCTCCCAGACGGGGTGGCGGCGG + Intronic
1200251516 X:154556709-154556731 CACCCCAGCCGTGGCGGCCGGGG + Intronic
1200266251 X:154647707-154647729 CACCCCAGCCGTGGCGGCCGGGG - Intergenic
1200324608 X:155223953-155223975 CCTCCCAGACGGGGTGGCGGCGG + Intronic
1201440276 Y:14000990-14001012 CCTCCCAGACGGGGTGGCGGTGG + Intergenic
1201444295 Y:14041718-14041740 CCTCCCAGACGGGGTGGCGGTGG - Intergenic