ID: 1177788238

View in Genome Browser
Species Human (GRCh38)
Location 21:25695505-25695527
Sequence GGGGCGGCCGCGGGGCAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 4624
Summary {0: 1, 1: 4, 2: 112, 3: 1191, 4: 3316}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177788221_1177788238 29 Left 1177788221 21:25695453-25695475 CCATCGTCATCATGGCCCGTTCT 0: 414
1: 1018
2: 754
3: 186
4: 228
Right 1177788238 21:25695505-25695527 GGGGCGGCCGCGGGGCAGAGGGG 0: 1
1: 4
2: 112
3: 1191
4: 3316
1177788223_1177788238 14 Left 1177788223 21:25695468-25695490 CCCGTTCTCAATGAGCTGTTGGG 0: 1398
1: 571
2: 139
3: 41
4: 130
Right 1177788238 21:25695505-25695527 GGGGCGGCCGCGGGGCAGAGGGG 0: 1
1: 4
2: 112
3: 1191
4: 3316
1177788225_1177788238 13 Left 1177788225 21:25695469-25695491 CCGTTCTCAATGAGCTGTTGGGT 0: 1045
1: 721
2: 149
3: 73
4: 160
Right 1177788238 21:25695505-25695527 GGGGCGGCCGCGGGGCAGAGGGG 0: 1
1: 4
2: 112
3: 1191
4: 3316

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177788238 Original CRISPR GGGGCGGCCGCGGGGCAGAG GGG Intronic
Too many off-targets to display for this crispr