ID: 1177791091

View in Genome Browser
Species Human (GRCh38)
Location 21:25722564-25722586
Sequence CATTATGAGGTATTGGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 387
Summary {0: 1, 1: 0, 2: 7, 3: 46, 4: 333}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177791083_1177791091 22 Left 1177791083 21:25722519-25722541 CCCTAAAGGTCTCATTTTAACTT 0: 2
1: 12
2: 134
3: 481
4: 1190
Right 1177791091 21:25722564-25722586 CATTATGAGGTATTGGAGGTTGG 0: 1
1: 0
2: 7
3: 46
4: 333
1177791082_1177791091 26 Left 1177791082 21:25722515-25722537 CCTACCCTAAAGGTCTCATTTTA 0: 3
1: 12
2: 142
3: 509
4: 1201
Right 1177791091 21:25722564-25722586 CATTATGAGGTATTGGAGGTTGG 0: 1
1: 0
2: 7
3: 46
4: 333
1177791085_1177791091 -6 Left 1177791085 21:25722547-25722569 CCCTGTCTCCAAAGTCACATTAT 0: 1
1: 0
2: 1
3: 29
4: 284
Right 1177791091 21:25722564-25722586 CATTATGAGGTATTGGAGGTTGG 0: 1
1: 0
2: 7
3: 46
4: 333
1177791084_1177791091 21 Left 1177791084 21:25722520-25722542 CCTAAAGGTCTCATTTTAACTTA 0: 2
1: 16
2: 113
3: 420
4: 1116
Right 1177791091 21:25722564-25722586 CATTATGAGGTATTGGAGGTTGG 0: 1
1: 0
2: 7
3: 46
4: 333
1177791086_1177791091 -7 Left 1177791086 21:25722548-25722570 CCTGTCTCCAAAGTCACATTATG 0: 1
1: 0
2: 1
3: 18
4: 173
Right 1177791091 21:25722564-25722586 CATTATGAGGTATTGGAGGTTGG 0: 1
1: 0
2: 7
3: 46
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177791091 Original CRISPR CATTATGAGGTATTGGAGGT TGG Intronic
900783659 1:4633991-4634013 CCTAATCAGATATTGGAGGTGGG + Intergenic
900821862 1:4895968-4895990 CATTTTTAGGTACCGGAGGTAGG - Intergenic
902999166 1:20252441-20252463 TATGATGAGGTACTGGAGGCTGG - Intergenic
905977079 1:42183524-42183546 CCTCATGAGTTATTGGAGGAGGG - Intronic
906568149 1:46815026-46815048 CAGCTTGAGGTATTGGAGGTGGG - Intronic
906699715 1:47849146-47849168 CATTCTGAGGTCCTGGGGGTGGG - Intronic
907583332 1:55591820-55591842 CATTCTGAAGTACTGGGGGTTGG + Intergenic
908736971 1:67286613-67286635 CATTCTGAGGTACTGGAGTTGGG + Intergenic
908891141 1:68849319-68849341 CATTTTGAGGTACTGAAGTTTGG + Intergenic
909333031 1:74437664-74437686 GTTTATGAGGTAAGGGAGGTGGG + Intronic
910460472 1:87443623-87443645 CATTCTGAGGCACTGGGGGTTGG - Intergenic
911158657 1:94660786-94660808 CATTCTGAGGTATTGTTGATTGG - Intergenic
911248379 1:95546299-95546321 CATTCTTAGATACTGGAGGTTGG - Intergenic
911926981 1:103845130-103845152 GATTGTGAGGTATTAGAGGATGG + Intergenic
913160376 1:116139794-116139816 CATTCTGAGGTGCTGGGGGTTGG - Intergenic
913264120 1:117027785-117027807 CATTAAAATGAATTGGAGGTCGG + Intronic
913498731 1:119451325-119451347 CATTATGAGGAAGTGGAGAGGGG + Intergenic
915518563 1:156428335-156428357 CATTGTGGGGTAGTGGAGGCTGG - Intronic
916227100 1:162499253-162499275 CTTTAGGAGGAATTGGAGGCTGG - Intronic
917124267 1:171671643-171671665 CATTCTGAGGTACTGGGGTTAGG + Intergenic
918969329 1:191394172-191394194 GATTATCAGGGATTGGAGGGAGG + Intergenic
920054113 1:203180456-203180478 TACTATGAGGTAATGGAGTTGGG - Exonic
920326394 1:205168168-205168190 CATGCTGAGGTTTTGAAGGTGGG + Intronic
920952548 1:210585924-210585946 CATGATCAGATATTGCAGGTGGG + Intronic
922760550 1:228127352-228127374 CTCTATGTAGTATTGGAGGTGGG - Intergenic
922819839 1:228476693-228476715 CATTCTGAGGTCCTGGGGGTAGG - Intergenic
923394666 1:233549768-233549790 CATTTTGAGGTACTGTGGGTTGG - Intergenic
924006120 1:239613484-239613506 CATTATGTGGTACTTGAGATTGG - Intronic
924757072 1:246951240-246951262 CATTCTGAGATACTGGGGGTAGG - Intronic
924796878 1:247299163-247299185 CATTCTGAGGTACTAGAGGTTGG - Exonic
1064316234 10:14260257-14260279 CTTTAAGAGGAATTGGAGTTTGG + Intronic
1065164519 10:22961039-22961061 CATTATGAGGTACTGGGGTTAGG + Intronic
1065620719 10:27578219-27578241 CATCAGGAGGTCTGGGAGGTAGG + Intergenic
1066641603 10:37559650-37559672 CATTTTGAGGTACTGGGGTTAGG + Intergenic
1071706598 10:88006229-88006251 CTTTGTGAGGAATGGGAGGTTGG + Intergenic
1072260514 10:93666024-93666046 CATTCTGAGGTACTGGGGATTGG + Intergenic
1072359142 10:94641994-94642016 CATTCTGAGGTATTGGGGGTTGG + Intergenic
1072882110 10:99237642-99237664 CATAGTGAAGTATTGGATGTTGG + Intergenic
1075572132 10:123553761-123553783 CATTATTAAGTGTTGGAAGTGGG - Intergenic
1075632178 10:124006944-124006966 CATTCTGAGGTACTCGAGATTGG - Intergenic
1076534036 10:131164786-131164808 CTTTAGGAGGCAGTGGAGGTGGG + Intronic
1079486539 11:20941168-20941190 CATTATGATATGTTGGAGGTGGG - Intronic
1080009390 11:27442248-27442270 CAAAATGTGGTATTGGAGCTGGG - Intronic
1080032119 11:27672836-27672858 CATTATGAGGGATTTGATGGGGG + Intronic
1083504787 11:63145981-63146003 TATTTTGAGGTATTAGGGGTTGG + Intronic
1084510827 11:69602529-69602551 CATGATGAGCTATTGCAGATGGG - Intergenic
1084526245 11:69699936-69699958 CATTAGCAGGTCATGGAGGTGGG + Intronic
1084543517 11:69801785-69801807 CAATTTGGGGTATAGGAGGTGGG - Intergenic
1086582035 11:88410423-88410445 CATTCTGAGGTACTGGGGTTAGG + Intergenic
1086606529 11:88702668-88702690 CATTCTAAGGTCCTGGAGGTTGG - Intronic
1087730456 11:101772741-101772763 CATTCTGAGGTACTGGGGGTGGG - Intronic
1088432956 11:109778586-109778608 CATTCTGAGGTACTGGGGTTAGG + Intergenic
1089180002 11:116576937-116576959 CATGCTGACCTATTGGAGGTTGG - Intergenic
1092910220 12:13139777-13139799 CAGGATGAGGAATTGGATGTAGG - Intronic
1092910246 12:13139897-13139919 CAGGATGAGGGATTGGATGTAGG - Intronic
1092910311 12:13140185-13140207 CAGGATGAGGAATTGGATGTAGG - Intronic
1095606465 12:44073370-44073392 CTTGATGGGGTATTGGGGGTGGG - Intronic
1095648256 12:44575961-44575983 TATTATGAGGTTTTAGAGGCAGG - Intronic
1095932876 12:47646723-47646745 CATTCTGAGGTACTGGGGGGTGG + Intergenic
1096212914 12:49780112-49780134 CATTCTGAGATACTGGGGGTAGG + Intergenic
1097265993 12:57745214-57745236 CATGGTGAGGTTTTGGAGGTGGG + Exonic
1098162901 12:67663983-67664005 CATTAAGAGGGATTTGAGGAAGG + Exonic
1098664623 12:73146647-73146669 CATTCTGAGGTACTAGGGGTTGG + Intergenic
1099443232 12:82723487-82723509 CATCATGAGGTACTGGGGATGGG + Intronic
1100477395 12:94947059-94947081 CATTTTGAGGTACTGGGGTTAGG - Intronic
1101306231 12:103530512-103530534 CATTATGAGGCATGAGGGGTGGG + Intergenic
1104610815 12:130226230-130226252 CATTATGTGGCAATGGAGGCAGG - Intergenic
1105809634 13:23983430-23983452 CATTCTGAGGTACTGGAGTCAGG + Intronic
1106084297 13:26526444-26526466 CATTCTGAGGTACTGGGGTTTGG - Intergenic
1106437856 13:29739757-29739779 CATTCTGAGGTCCTGGGGGTAGG - Intergenic
1107013871 13:35693916-35693938 CATTCTGAGATACTGGAGCTTGG - Intergenic
1107290631 13:38849105-38849127 CATCCTCAGGTATTGGGGGTTGG + Intronic
1107728480 13:43324108-43324130 CACCATCAGGCATTGGAGGTGGG + Intronic
1110029781 13:70594745-70594767 CACTATTAGGTCTTTGAGGTAGG - Intergenic
1110242348 13:73283138-73283160 CATTCATAGGTATTGGAGGTTGG - Intergenic
1110511289 13:76354550-76354572 CACTATGAGGTACTGGGGATTGG + Intergenic
1110929473 13:81196580-81196602 AATTCTGAGGTGTTAGAGGTTGG + Intergenic
1114752403 14:25219780-25219802 CATTCTGGGGTATTGGGGTTGGG - Intergenic
1115398832 14:32937145-32937167 CATTGGCAGGTGTTGGAGGTAGG + Intronic
1115518652 14:34210562-34210584 CATTTTGTGGTATAGCAGGTAGG - Intronic
1116700308 14:48232676-48232698 CATTCTGAGGTACTGAGGGTAGG - Intergenic
1116822488 14:49639083-49639105 TTATATGAGGTGTTGGAGGTGGG - Intergenic
1118090842 14:62475769-62475791 CATTCTGAGGTATTGGCAGCAGG - Intergenic
1120092113 14:80343994-80344016 CATTCTGAGGTACTGGCGTTAGG + Intronic
1120458923 14:84768427-84768449 CATTCTGAGATATTGGTGGGGGG - Intergenic
1121051667 14:90822941-90822963 GATTATGAGATACTGGGGGTTGG - Intergenic
1121148763 14:91610763-91610785 CATTTTGAGATACTGGAGGTTGG - Intronic
1122432970 14:101667612-101667634 CATTCTGAGGCACTGGGGGTTGG + Intergenic
1122869403 14:104629257-104629279 CATTCTGAGGTACTGGGGATTGG + Intergenic
1122929250 14:104925908-104925930 CGTTATGGGGGATTGGGGGTAGG - Intronic
1123898488 15:24851750-24851772 CATTATGAGGAATTGGTTCTAGG + Intronic
1124076159 15:26446308-26446330 CATTCTGAGGTACTGGGTGTTGG + Intergenic
1124606537 15:31173544-31173566 CGTTCTGAGGTATGGGAGTTAGG + Intergenic
1125135405 15:36335189-36335211 CATTGTGAGGTACTGGGAGTTGG + Intergenic
1125560148 15:40624608-40624630 CTTTTTTAGGTAATGGAGGTTGG - Exonic
1126166611 15:45659050-45659072 CATTATGAGGTGCTGGTGCTGGG + Exonic
1127263361 15:57342176-57342198 CATTCGGAGGTACTGGGGGTTGG - Intergenic
1128317903 15:66672614-66672636 CACTCTGAGGTACTGGGGGTTGG + Intronic
1129515904 15:76157371-76157393 AAGTAAGAGGTATTGGAGCTGGG + Intronic
1131354281 15:91731007-91731029 CACTTTGAGAGATTGGAGGTGGG + Intergenic
1131375596 15:91920447-91920469 CAGAATGGAGTATTGGAGGTAGG + Intronic
1131564735 15:93475938-93475960 CATTCTGACGTACTGGAGATTGG - Intergenic
1131741572 15:95398593-95398615 CATTTTGAGGTATTGGGGTTTGG + Intergenic
1131828554 15:96339813-96339835 CATGATGAAGTACTGGCGGTGGG - Exonic
1133571937 16:7049612-7049634 CACTAAGGGGTATTGGTGGTGGG + Intronic
1134180920 16:12047011-12047033 CATTGCGGGGAATTGGAGGTGGG + Intronic
1134692860 16:16202464-16202486 CATTCAGAGGTACTGGGGGTCGG - Intronic
1134978987 16:18592231-18592253 CATTCAGAGGTACTGGGGGTCGG + Intergenic
1135209225 16:20509924-20509946 CATTCTAAGGTATTCGGGGTTGG + Intergenic
1135307659 16:21380772-21380794 CATTGCGGGGAATTGGAGGTGGG + Intergenic
1135417290 16:22278336-22278358 CATTGTGAGGTATTAGGAGTTGG - Intronic
1135923186 16:26669467-26669489 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1136304403 16:29359892-29359914 CATTGCGGGGAATTGGAGGTGGG + Intergenic
1137927607 16:52555466-52555488 CATTATAAAGTATTGAAGGCTGG + Intergenic
1139025488 16:62812524-62812546 CATTTTGAGGTACTGAGGGTTGG - Intergenic
1139337367 16:66242167-66242189 CAGTATGAGGTGTGGGAGGGTGG + Intergenic
1140199153 16:72880316-72880338 CATCCTCAGGTACTGGAGGTTGG - Intronic
1140706305 16:77633443-77633465 CATTTTGAGGTACTGGGGTTAGG + Intergenic
1140812014 16:78587635-78587657 CATTTTGAGGAATTGGGTGTGGG + Intronic
1140879664 16:79186606-79186628 CATTCTGAGGCAATGGCGGTTGG + Intronic
1143901147 17:10175848-10175870 CATTCTGAGGTACTAGGGGTTGG + Intronic
1145043947 17:19597644-19597666 GATGATGATTTATTGGAGGTTGG - Intergenic
1146315059 17:31800326-31800348 CATTTTGAGGTTCTGGGGGTTGG + Intergenic
1146978043 17:37132686-37132708 CATTATCAGGTATTAGAGATAGG - Intronic
1147040798 17:37717244-37717266 CATTATCAGGGATGGGAGGTTGG - Intronic
1148735733 17:49863928-49863950 CTTTGTTAGGTATTGGAGGAAGG + Intergenic
1149071058 17:52543863-52543885 CATTCTGAGGTACTAGGGGTTGG - Intergenic
1149126430 17:53239674-53239696 CATTTTGAAGTATTGGAGGTTGG + Intergenic
1149594107 17:57853661-57853683 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1150850728 17:68701467-68701489 CATTATGAGCTGGTGGAGCTGGG + Intergenic
1151643652 17:75414821-75414843 CATTCTTAGGTACTGGGGGTGGG - Intergenic
1153885501 18:9461079-9461101 CATTCTGAGGTACTGGGGTTAGG - Intergenic
1155076306 18:22359019-22359041 TATCATGAGGTATTAGAGGTGGG - Intergenic
1155432077 18:25769975-25769997 CATTATGAGGAACTGCAGGCAGG - Intergenic
1155776516 18:29768375-29768397 CATTCACAGGTATTGGGGGTAGG + Intergenic
1156260182 18:35439135-35439157 CACTCTGAGGTACTGGGGGTAGG - Intergenic
1156782670 18:40869953-40869975 CATTAGGAGGCATTGGATGAGGG + Intergenic
1157134050 18:45036837-45036859 CATGATCAGGTATTAGAGTTTGG + Intronic
1157185438 18:45536657-45536679 CATTCTCAGGTATTGGGGGTTGG + Intronic
1158341706 18:56473248-56473270 CATTCCGATGTACTGGAGGTTGG + Intergenic
1161536576 19:4822923-4822945 CATTCTGAGCTACTGGAGGTTGG - Intronic
1162157874 19:8692034-8692056 CATTCTCAGGTACTGGGGGTTGG + Intergenic
1162172576 19:8803058-8803080 CATTCTGAGGTACTGGGGTTAGG - Intergenic
1165127345 19:33608479-33608501 AATTAAGAATTATTGGAGGTTGG + Intergenic
1165141152 19:33700707-33700729 CATTATGCACAATTGGAGGTGGG + Intronic
1166038351 19:40186275-40186297 CATTCTGAGGTACTGGGAGTAGG + Intergenic
1166833695 19:45653827-45653849 CTTGATGAGTTATGGGAGGTGGG + Intergenic
1167757222 19:51420438-51420460 CATTCTTAGGTACTGGAGGTTGG + Intergenic
1167770165 19:51509869-51509891 CATTCTTAGGTACTGGACGTTGG + Intergenic
1168265160 19:55219330-55219352 CATTCTGAGGTACTGGAGGTTGG + Intergenic
925009900 2:476032-476054 CATGCTGAGGTACTGGGGGTAGG - Intergenic
925281088 2:2685479-2685501 CCTTGTGATGTATTAGAGGTGGG - Intergenic
926474352 2:13303744-13303766 CATTGTGAGGTACTGGAGTCAGG + Intergenic
927066381 2:19475334-19475356 CATTCTGAGGTACTAGGGGTTGG - Intergenic
927585141 2:24296412-24296434 CATTCTGAGGTACTGGGGCTTGG - Intronic
929503981 2:42513874-42513896 CAATTTGAGGTAGTGGAGGGAGG - Intronic
929958538 2:46479154-46479176 CATTCTGAGGTACTGGGGGCTGG + Intronic
931420083 2:62119009-62119031 CATTCTGAGGTACTGGGAGTTGG - Intronic
931778215 2:65557752-65557774 CATTCTGAGCTGCTGGAGGTAGG + Intergenic
932824280 2:74925595-74925617 TCTTAAGAGGTTTTGGAGGTAGG + Intergenic
933100097 2:78244565-78244587 CATTTTGAGGTACTGGGGTTAGG - Intergenic
933213955 2:79604748-79604770 AATTAGGAGGTACTGGAGATAGG + Intronic
933648525 2:84831061-84831083 CATTCTGAGGTACTGGGGATGGG - Intronic
934575107 2:95395278-95395300 CATTCTGAGGTACTGGGGTTAGG - Intergenic
935017815 2:99200797-99200819 CAATAGGAGGTATTTGATGTGGG + Intronic
935127360 2:100236133-100236155 CATTCTGAGGTACAGGAGTTAGG - Intergenic
935611670 2:105032113-105032135 CATTAGGAGGTATAGCAGGTGGG + Intergenic
936230013 2:110692399-110692421 CATCCTGAGGTATTGGGGTTAGG - Intergenic
936853825 2:116933724-116933746 CATTCTGAGGCATTGGGGTTAGG - Intergenic
937666156 2:124489502-124489524 CATTCTGAGGTACTGGGGGCTGG + Intronic
937958154 2:127434930-127434952 CATTCCGAGTTTTTGGAGGTTGG - Intergenic
938154639 2:128923920-128923942 CATTATAAGGAGTTGGATGTTGG + Intergenic
939440355 2:142240882-142240904 CATTCTGAGATCTTGAAGGTTGG - Intergenic
940157620 2:150675951-150675973 CATTCTGAGATACTGGGGGTTGG - Intergenic
940376385 2:152963575-152963597 CATAATGAGGGATTGGTTGTTGG + Intergenic
941116152 2:161474607-161474629 CATTAAGAAGTATAGGAAGTTGG - Intronic
941956376 2:171209596-171209618 CATTATGAGATATGGGAATTAGG - Intronic
942412998 2:175731207-175731229 CATTCTGAGTTACTGGGGGTTGG - Intergenic
942752569 2:179304369-179304391 CATTCTGAGGTACTGGGGTTAGG - Intergenic
943242172 2:185399339-185399361 CATTTTGAGGTACTGGGGATTGG - Intergenic
943640669 2:190354405-190354427 CATTCTGAGGTACTGGGGGTTGG - Intronic
944109725 2:196119440-196119462 CATTATGAGGAATGTGAGTTTGG + Intergenic
945175319 2:207037927-207037949 CATTCTGAGGTACTGGGGTTAGG - Intergenic
945190281 2:207180624-207180646 GATTCAGAGGTACTGGAGGTTGG + Intergenic
945725403 2:213467673-213467695 CATTTTGAGTTATTGGAGCCAGG + Intronic
946013127 2:216582616-216582638 CATTCTGAGGCACTGGGGGTTGG + Intergenic
946366079 2:219249891-219249913 CATTATGAGGGTTTGGGAGTGGG - Exonic
946528387 2:220544310-220544332 CATTTTGACATACTGGAGGTTGG + Intergenic
946811862 2:223534192-223534214 CATTTTGAGATACTGGAGTTAGG - Intergenic
947499635 2:230662507-230662529 CATTGTGAGGTACTGGGGCTAGG + Intergenic
948679352 2:239622107-239622129 CACTCTGAGGTACTGGAGTTAGG - Intergenic
948934319 2:241152510-241152532 GATTTGGAGGTTTTGGAGGTGGG + Intronic
1170753158 20:19170696-19170718 CATTCTGAGGTACTGGGGATAGG - Intergenic
1173014709 20:39214699-39214721 CATTATGAGCTACTGAAGGCAGG + Intergenic
1173884253 20:46443404-46443426 GACTATGTGGTATTGGAGGATGG - Intergenic
1176227381 20:64008986-64009008 AATAATGAGGTATTTTAGGTCGG + Intronic
1177116233 21:17090385-17090407 CATTCTGAGGTACTGGGGGTTGG + Intergenic
1177622103 21:23610147-23610169 CATTCTGAGGTACTGGGAGTAGG - Intergenic
1177791091 21:25722564-25722586 CATTATGAGGTATTGGAGGTTGG + Intronic
1178204494 21:30447589-30447611 GAATATGAGGAATTGGAGGCTGG + Intergenic
1178627891 21:34233469-34233491 CACTCTGAGGTACTGGGGGTTGG + Intergenic
1178999545 21:37443928-37443950 CATTCTGAGGTACTGGGGTTAGG + Intronic
1179332688 21:40420590-40420612 CATTCTGAGATACTGGTGGTAGG - Intronic
1183065834 22:35362092-35362114 CAGAGTGAGGTAGTGGAGGTGGG + Intergenic
1183276126 22:36899382-36899404 TATTCTGAGGTATTGGGGTTAGG + Intergenic
1184766320 22:46574385-46574407 CATTGGGAGGTATGGGAGTTAGG + Intergenic
1184941839 22:47773755-47773777 CATTCTGAGGTACTGGGGTTAGG - Intergenic
1185012867 22:48325468-48325490 CATTCTGAGGTACTGGGAGTGGG + Intergenic
1185014690 22:48336036-48336058 CATGCTGAGGTCTTGGGGGTTGG + Intergenic
953236671 3:41113195-41113217 CATTCTGAGGTACTGGGGTTAGG - Intergenic
954149923 3:48652272-48652294 CTTTCTGTGGCATTGGAGGTGGG - Intronic
954992179 3:54851009-54851031 GAGTTTGAGTTATTGGAGGTAGG - Intronic
955191165 3:56762727-56762749 TATTATCAGGGATTGGAGGTTGG + Intronic
955515226 3:59719897-59719919 CATAATGAGGTGGTGGTGGTGGG - Intergenic
955929525 3:64042516-64042538 CATAATTAGGTATGGGAGGAGGG - Intergenic
960443475 3:117718298-117718320 AATTATGAGGTTTTGGAGGCAGG + Intergenic
961178333 3:124854964-124854986 TATTATGAGGCATGGGGGGTAGG + Intronic
961341651 3:126227147-126227169 CATTCTGAGGTACTGGGGTTAGG - Intergenic
963370618 3:144395108-144395130 CATTCTGAGGTACTGGGGGTTGG + Intergenic
967506276 3:190256229-190256251 CATTCTGATGTGTTGGATGTCGG + Intergenic
968507331 4:976913-976935 CATTCTGAGGTGCTGGGGGTTGG - Intronic
969954209 4:10871536-10871558 CATTTTGAGGTACCGGGGGTCGG + Intergenic
970138376 4:12951433-12951455 CATTCTGAGGTACTAGGGGTAGG + Intergenic
970417211 4:15871199-15871221 CATTCTGAGGTACTGGGGTTAGG - Intergenic
970745351 4:19287989-19288011 CATTATAAGGCATTGTGGGTAGG - Intergenic
970872065 4:20827532-20827554 CAGTCTGAGGTACTGGATGTTGG + Intronic
971083016 4:23237164-23237186 GATTCTGAGCTATTGAAGGTAGG - Intergenic
971854005 4:32020482-32020504 CATTTTGAGGTATTGGTGATCGG + Intergenic
971945043 4:33264283-33264305 CATTCTGATGAATTGGATGTGGG + Intergenic
973082675 4:46013428-46013450 TAATCTCAGGTATTGGAGGTGGG - Intergenic
973716906 4:53685869-53685891 CATTCTGGGGTATTGGGGGTAGG + Intronic
974241961 4:59260939-59260961 CATTCTGAGGTACTGAGGGTTGG - Intergenic
974697047 4:65389733-65389755 CATTGAGAACTATTGGAGGTAGG + Intronic
976153388 4:82115803-82115825 CATTCTGAAGTACTGGAGTTAGG - Intergenic
976320908 4:83714205-83714227 GTTTATAAGGTATAGGAGGTGGG + Intergenic
976885706 4:89981081-89981103 CATTCTGAGATACTGGGGGTTGG - Intergenic
977211706 4:94225544-94225566 CATTTTGAGGTATTGGTGATTGG + Intronic
977247145 4:94646203-94646225 CATTCTGAGGTACTGGAATTTGG - Intronic
977784471 4:101016608-101016630 CATTGTGAGGTACTGGGGGTGGG + Intergenic
977986802 4:103392145-103392167 CATAAAGAGGTAGTGGTGGTGGG - Intergenic
979092405 4:116501920-116501942 CATGCTGAGGTACTGAAGGTTGG - Intergenic
979796271 4:124850468-124850490 TATTTTGAGGTATAGGAGATAGG + Intergenic
980025704 4:127763754-127763776 CATTGTGAAGTATTTTAGGTTGG + Intronic
980656193 4:135790040-135790062 CATTTTGAGGAAGTTGAGGTGGG - Intergenic
981856136 4:149295195-149295217 CATTCTGAAGTATTGGAGGTTGG - Intergenic
982260379 4:153489055-153489077 CATTCTGAGGTACTGGGGTTAGG + Intronic
982280583 4:153680376-153680398 CAATGTGAGGTACTGGAGGTGGG - Intergenic
982293504 4:153803649-153803671 CATTCTGAGGTACTGGGAGTTGG + Intergenic
982359673 4:154505965-154505987 CATGTTTAGGTATTGGAGGTAGG - Intergenic
984589553 4:181601801-181601823 CATTCAGAGGTACTGGGGGTTGG + Intergenic
986030055 5:3885051-3885073 CATTCTGAGGTACTTGGGGTTGG + Intergenic
986460058 5:7960774-7960796 CATTATGAGTTATTGGGGTGGGG + Intergenic
987222561 5:15805198-15805220 CATTCTGAGGTACTGGAAGTTGG + Intronic
987785335 5:22492030-22492052 CATTCTGAGGTAATGGGAGTTGG + Intronic
988189557 5:27910818-27910840 CATTCTGAGGTACTGGTGTTAGG + Intergenic
989094603 5:37770188-37770210 CATTCTAAGGTATTGGGGTTAGG - Intergenic
989286838 5:39710026-39710048 CACCATGCGGTATAGGAGGTGGG + Intergenic
990144701 5:52745795-52745817 CATTCTGAGGTACTGGGGTTAGG + Intergenic
990947161 5:61261577-61261599 CATTCTGAGGTATGGGAGTTAGG - Intergenic
990961807 5:61401529-61401551 TATTATGAGGTATATGAGATAGG + Intronic
991122760 5:63034488-63034510 CATTATGAGCAACTTGAGGTAGG - Intergenic
991607870 5:68421513-68421535 CATTCTGAGGTACAGGGGGTTGG - Intergenic
992198217 5:74360474-74360496 CATTCTGAGGTACTAGGGGTAGG + Intergenic
992246847 5:74834670-74834692 CAGTATGAGGTATGGGAGCAGGG - Intronic
992614921 5:78538528-78538550 CAATATGAAGTATTGGAGACTGG - Intronic
992905021 5:81337416-81337438 GATTCTGAGGTACAGGAGGTTGG - Intronic
993732363 5:91437580-91437602 CATTCTGAGGTAGTGGGGGTTGG + Intergenic
993734340 5:91458318-91458340 CATTCTGAGGTACTGATGGTTGG - Intergenic
994267062 5:97729720-97729742 CATTATGATGTATGGATGGTGGG - Intergenic
994746299 5:103682505-103682527 GCTTATGAGGTTTTGGAGGCTGG - Intergenic
995224220 5:109686049-109686071 CACTCTGAGGTACTGGGGGTTGG + Intergenic
996509144 5:124299482-124299504 CATTCTGAAGTACTGGAGTTAGG + Intergenic
997359201 5:133283682-133283704 CATTATGAGGAATTGGACAGTGG + Intronic
998360390 5:141581000-141581022 CATTTTGAGGTACTGGGGGTTGG - Intronic
999067828 5:148710319-148710341 CATTCTGAGGTACTAGGGGTTGG + Intergenic
999893296 5:156002093-156002115 CATTCTGAGGTCCTGGAGGTTGG - Intronic
1000709767 5:164558244-164558266 AATTAAGAGGTATTTGAGGAAGG + Intergenic
1001707195 5:173750100-173750122 CATTTTGAGGTACTAGGGGTAGG - Intergenic
1001773700 5:174313431-174313453 CATTCTGAGGTACTAGGGGTTGG + Intergenic
1002765161 6:233040-233062 CATTCTGAGGTATTGGGGTAAGG - Intergenic
1003466007 6:6380732-6380754 CATTCTGAGGTACTGGGGGTTGG - Intergenic
1004255724 6:14062190-14062212 CATTCTGAGGTTTTGGGGTTAGG - Intergenic
1004402313 6:15299998-15300020 CATTATAACCTTTTGGAGGTTGG - Intronic
1004510544 6:16280783-16280805 CATTATTAGGTAATGGAGACAGG - Intronic
1004732557 6:18372466-18372488 GTTTATGAGGTGTTGGAGGCAGG - Intergenic
1005506994 6:26478035-26478057 CATTACCAGGAAGTGGAGGTGGG + Intergenic
1005726144 6:28650826-28650848 CATTCTGAGGTACTGAGGGTAGG - Intergenic
1007101501 6:39250638-39250660 CATTCTGAGGTACTGGGAGTTGG + Intergenic
1007320600 6:41026361-41026383 CATTTTGAGAAATTGGAGTTGGG + Intergenic
1007714726 6:43849197-43849219 CCTTGGGAGGTATTAGAGGTTGG + Intergenic
1008331341 6:50248081-50248103 CATTCTGAGGTATTGGGGTTAGG - Intergenic
1008654368 6:53596465-53596487 CATTCTGAGGTATGGGGTGTTGG + Intronic
1009358633 6:62786339-62786361 TATTCTGAGGTACTGGAGTTAGG + Intergenic
1010917021 6:81632743-81632765 CTTTATGCTGTCTTGGAGGTTGG + Intronic
1012153507 6:95786180-95786202 CATTCTGAGGTAGTGAAGTTAGG + Intergenic
1013154495 6:107480667-107480689 CACTAGGAGGTGTAGGAGGTGGG - Intergenic
1015051147 6:128841879-128841901 CATTCTGAGGTACTGAGGGTTGG + Intergenic
1015293724 6:131566661-131566683 CATTAGGAGGGATTTGACGTTGG - Intergenic
1015310576 6:131762576-131762598 CATTCTGGGGTATTGGGGTTAGG - Intergenic
1016136126 6:140545792-140545814 CATTCTGAGGTATGGGTGTTAGG + Intergenic
1016631117 6:146232788-146232810 CATTCTGATGTACTGGGGGTTGG + Intronic
1016659946 6:146566756-146566778 CATTCTGAGGTACTGGAGGTTGG - Intergenic
1016787778 6:148031742-148031764 CATTCTGAGGCACTGGGGGTAGG + Intergenic
1017230799 6:152071181-152071203 GATCATGAGGTCTTTGAGGTAGG - Intronic
1017433217 6:154391573-154391595 CATTCTGAGGTACTGGGGTTAGG + Exonic
1018035443 6:159877506-159877528 CATTCTGTGGTACTGGAGGTTGG - Intergenic
1018977804 6:168578772-168578794 TATTATGAAGAATTGGACGTGGG + Intronic
1020891569 7:13884810-13884832 CATTCTGAGGTACTGGGGTTAGG - Intergenic
1021818574 7:24474411-24474433 CAATATGTGGTATTGGAGCAAGG - Intergenic
1022908933 7:34881545-34881567 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1023134137 7:37034145-37034167 CATTCTGAGGTACTGGGGTTAGG - Intronic
1024198193 7:47080830-47080852 CCTTATGAGGAATTGGAAATAGG + Intergenic
1026013046 7:66651888-66651910 CATTCTGAGGTATTGGAGTTAGG - Intronic
1026235459 7:68522965-68522987 TATTCTGAGGTATTGGGGTTAGG - Intergenic
1026351248 7:69517254-69517276 CATTATTAGTAACTGGAGGTGGG + Intergenic
1027862011 7:83596203-83596225 CATTGTGAGGTTTTTCAGGTTGG + Intronic
1028097403 7:86778841-86778863 CATTCTAAGGTACTGGGGGTTGG - Intronic
1028430405 7:90740367-90740389 CATTCTGAGGTACTGGGGGCTGG - Intronic
1028498675 7:91492297-91492319 CATTAGGAGGTATTGTCGTTGGG + Intergenic
1028849709 7:95524610-95524632 CGTGCTGAGGTATTGGAGGTTGG - Intronic
1029090723 7:98046089-98046111 CATTCTGACGTCCTGGAGGTTGG - Intergenic
1030328925 7:108252159-108252181 TTTTATGAGGTATTGGGTGTGGG + Intronic
1030595696 7:111536273-111536295 CAATATGAAATATTGGTGGTGGG + Intronic
1030646229 7:112064708-112064730 CATTCTGAGGTATTGAGGTTAGG - Intronic
1031865916 7:127039174-127039196 CATTCTGAGCTACTGGAGGTTGG - Intronic
1032508622 7:132454592-132454614 CATTCAGAGGTACTGGGGGTTGG - Intronic
1033041289 7:137920833-137920855 CATTCTGAACTACTGGAGGTTGG + Intronic
1033592091 7:142817770-142817792 CATTCTGAGGTACTGAGGGTTGG + Intergenic
1033956260 7:146852106-146852128 CATTCTGAGACATTGGGGGTTGG + Intronic
1034204568 7:149304389-149304411 CATTATGAGGTACTGAGGTTTGG - Intergenic
1035011276 7:155717481-155717503 CATTCTGAGGTACGGGGGGTTGG + Intronic
1035913197 8:3592338-3592360 TATTATTAGGTATCGAAGGTAGG + Intronic
1037436131 8:18865562-18865584 CATTTTGTGTTATTTGAGGTTGG - Intronic
1037716039 8:21401042-21401064 CATAATGAGATATAGGAGGCAGG - Intergenic
1037844109 8:22267452-22267474 CATTATAAGGTTCTGGAGGAGGG - Intergenic
1038165541 8:25081875-25081897 CATTCTGAGGTACTGGAATTTGG + Intergenic
1040991548 8:53356658-53356680 CATGATGAGGTAGTGGAGTGAGG + Intergenic
1041391897 8:57354271-57354293 CATTCTGAGGTACTGGGGGTAGG + Intergenic
1041516151 8:58700782-58700804 CATTCTGAGGCATAGGGGGTTGG - Intergenic
1041662217 8:60411532-60411554 CATTCTGAGGTACTGGGGTTAGG + Intergenic
1042449823 8:68931292-68931314 CATTCTGAGGTACTGGAGACTGG + Intergenic
1043276855 8:78408351-78408373 CATTCTGGGGTACTGGAGTTGGG - Intergenic
1043570923 8:81601555-81601577 CATGATGGAGTAATGGAGGTGGG - Intergenic
1043575427 8:81651005-81651027 GATGATGAAGTAATGGAGGTGGG - Intergenic
1043880368 8:85535604-85535626 CATTCTGAGGTACTGGGTGTGGG + Intergenic
1044110215 8:88263789-88263811 CATTCTGGGGTACTGGGGGTTGG + Intronic
1044790729 8:95844279-95844301 CATTCTGGGGTACTGGGGGTTGG + Intergenic
1044938690 8:97318430-97318452 CATTCTGAGATACTGGAGTTAGG + Intergenic
1045487225 8:102640838-102640860 CATTCTGAGGTACTGGGGTTAGG - Intergenic
1045511829 8:102817547-102817569 CATTCTGATGTACTGGTGGTTGG - Intergenic
1046852735 8:118993794-118993816 CATTCTGAGATACTGGGGGTTGG + Intergenic
1047567236 8:126059210-126059232 CATTTTGAGGTACTGGGGGTTGG - Intergenic
1047920738 8:129632017-129632039 CATTCTGAGGTATTGAGGATAGG - Intergenic
1048946164 8:139449499-139449521 CATTTTGAGATAATGGAGATGGG + Intergenic
1049318420 8:141982082-141982104 CTGGAAGAGGTATTGGAGGTTGG + Intergenic
1049498209 8:142946623-142946645 CACTCGGAGGTATTGGGGGTTGG + Intergenic
1050002646 9:1094877-1094899 CATAGTGAGGTGTTGGAGATAGG - Intergenic
1051553602 9:18357902-18357924 CATTATGGGGCAGTGGGGGTAGG - Intergenic
1051778171 9:20658881-20658903 CATTCTGAGGTACTAGGGGTTGG - Intronic
1051891011 9:21942959-21942981 CATTTTGAGGTATTGCAGTTAGG + Intronic
1051899435 9:22023435-22023457 CATTATGAAATTTTGGGGGTTGG + Intronic
1054699255 9:68396169-68396191 TTTTATGAGGTAATTGAGGTAGG + Intronic
1055230668 9:74061140-74061162 GATTATTAGGTATTAGGGGTAGG - Intergenic
1055573901 9:77644061-77644083 CATTCTGAGGTACTAGTGGTTGG - Intronic
1056343539 9:85665104-85665126 TATTTGGAGGTATTGGGGGTTGG - Intronic
1056347756 9:85716573-85716595 CTTTCTGATGTATTGGATGTGGG - Intronic
1056526415 9:87446941-87446963 CAGCATGAGGTAGTGGAGCTGGG - Intergenic
1056957838 9:91096704-91096726 CATTCTGAGGTACTGGGAGTTGG + Intergenic
1061247781 9:129409908-129409930 CATTCTGAGGGACTGGAGTTAGG - Intergenic
1187248785 X:17578200-17578222 TAACATGAGGTATTGGATGTTGG - Intronic
1187536858 X:20148890-20148912 CATTCTCAGGTACTGGGGGTTGG - Intergenic
1188384929 X:29544821-29544843 CATTCTGAGGTATTGGGGGTAGG - Intronic
1189136771 X:38558672-38558694 CATTCTGAGGTACTGGGGTTAGG + Intronic
1189346173 X:40243091-40243113 CATTCTGAGGTATTGGGTTTAGG + Intergenic
1190009821 X:46774855-46774877 CATTCTGAGGTACTAGGGGTTGG + Intergenic
1190809304 X:53868156-53868178 CTTTATTAGGCATTGGAGGAGGG + Intergenic
1190823029 X:53992549-53992571 CATGGTGTGGTGTTGGAGGTGGG - Intronic
1194962254 X:100249213-100249235 CATCATGATCTATTGCAGGTTGG + Intergenic
1195612803 X:106888038-106888060 CATTCTGAGTTACTGGGGGTTGG - Intronic
1195814396 X:108869292-108869314 GAATAGAAGGTATTGGAGGTTGG + Intergenic
1196352915 X:114754160-114754182 CATTCTGAGGTACTGGGGTTAGG + Intronic
1196634535 X:117986956-117986978 CACTATGAAGTCTGGGAGGTGGG - Intronic
1197574538 X:128194278-128194300 CATTCTGAGGTTTTGGGAGTTGG + Intergenic
1198339320 X:135698845-135698867 CACTATGAGTTATTCCAGGTTGG - Intergenic
1199343735 X:146713713-146713735 AATTTTGAGGCATTGGTGGTTGG - Intergenic
1199990027 X:152982356-152982378 CATTCTGAGGTACTGGAGTTAGG + Intergenic
1200180687 X:154148701-154148723 CATTCTGAGGTATTGGGGTTAGG + Intronic