ID: 1177791471

View in Genome Browser
Species Human (GRCh38)
Location 21:25726686-25726708
Sequence TAGCATTATGGACCAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177791467_1177791471 28 Left 1177791467 21:25726635-25726657 CCAAGCAATAAAATGACAAAATT 0: 1
1: 0
2: 5
3: 66
4: 626
Right 1177791471 21:25726686-25726708 TAGCATTATGGACCAGCAGCAGG 0: 1
1: 0
2: 0
3: 6
4: 61

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177791471 Original CRISPR TAGCATTATGGACCAGCAGC AGG Intronic
904584137 1:31569802-31569824 GAGCATAATGGACAAGCAGAGGG - Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
906127740 1:43437871-43437893 CAACACCATGGACCAGCAGCTGG - Exonic
910345417 1:86231139-86231161 TAGGACTGTGCACCAGCAGCAGG - Intergenic
911554827 1:99330538-99330560 TTGCTTTATGGCCCAGCAGATGG - Intergenic
912419006 1:109530915-109530937 TAGCATTCAGGACCAGTAGTGGG - Intergenic
912432985 1:109639297-109639319 ATGCAAGATGGACCAGCAGCTGG + Intergenic
913338279 1:117731613-117731635 TAGCTTTGTGGTCCAGGAGCAGG + Intergenic
915706561 1:157849360-157849382 TAGCATCAGGGAACAGCAGGTGG + Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
921590178 1:216993795-216993817 CATCATTATGGACCAGGAGCTGG - Intronic
924548473 1:245052307-245052329 CAGGATTATGGACTAACAGCAGG + Intronic
1063082300 10:2779692-2779714 TATCATTATGCACCATCATCTGG + Intergenic
1064194328 10:13233255-13233277 TAGCATCATGGCCAAGAAGCAGG + Intronic
1074604564 10:114948350-114948372 TAGCAGTATAGAAGAGCAGCAGG - Intronic
1075990662 10:126836194-126836216 TACCATTCTGGGCCACCAGCAGG + Intergenic
1076516468 10:131047776-131047798 TAGCATTATGCACAAGAAGAAGG - Intergenic
1090923525 11:131229888-131229910 TACAATTATGGACACGCAGCAGG + Intergenic
1093774781 12:23060745-23060767 TAGTGTTATGGACCAACTGCAGG - Intergenic
1100870999 12:98909987-98910009 TAGCCTGATGGATCAGCACCTGG - Intronic
1102090288 12:110181513-110181535 TTGCATTATGGCCCAGCATACGG + Intronic
1108965417 13:56292919-56292941 TAGCATTATGAATCATCATCAGG - Intergenic
1110176050 13:72556550-72556572 TAGCATTATGGAAGATCAGCAGG + Intergenic
1114818438 14:25987326-25987348 TAGCAGTTGGGACCAGCAGGGGG - Intergenic
1115645922 14:35368375-35368397 TAGCTTTAGGGACCAGCCTCAGG - Intergenic
1138299849 16:55916851-55916873 TGGCAACCTGGACCAGCAGCTGG - Intronic
1139198948 16:64952764-64952786 TAGCATCATGGCCCAATAGCTGG + Intronic
1149480691 17:57000910-57000932 TAGCATTGTGGACGAGTTGCTGG + Exonic
1155890414 18:31261544-31261566 TATAATTGTGGACCAGCAGTTGG + Intergenic
1158389347 18:57032045-57032067 TAGCAATATGGCAAAGCAGCTGG - Exonic
925253509 2:2462714-2462736 CAGCATAATGGAGCAGCAGTGGG + Intergenic
933599945 2:84318813-84318835 AAGCAGTTTGGACCAGCTGCAGG - Intergenic
937139582 2:119588187-119588209 TAGAATTATGGACCATCAGAGGG - Intronic
942202827 2:173589277-173589299 TAGCAGTCTGGACCAGCCGCTGG + Intergenic
943778856 2:191799077-191799099 TAGCATTATAGTTCAGCATCAGG + Intergenic
948314508 2:237016987-237017009 GAGCATTAGGGACCAGCACTGGG - Intergenic
1172456811 20:35082346-35082368 TTGCAGTATGGCCTAGCAGCTGG - Intronic
1173099977 20:40077294-40077316 TACCAAAATGGACCAGCTGCTGG + Intergenic
1174304039 20:49602647-49602669 GAGCATTAAGGGCCATCAGCAGG - Intergenic
1177791471 21:25726686-25726708 TAGCATTATGGACCAGCAGCAGG + Intronic
1178364034 21:31973657-31973679 TAGAATTAAGAACCGGCAGCCGG - Intronic
1179657145 21:42852484-42852506 TGGCATCATGGGCCAGCTGCGGG - Intronic
1181151355 22:20885691-20885713 TGGCACTGTGGACGAGCAGCTGG + Intronic
956766116 3:72485953-72485975 TTGGAAGATGGACCAGCAGCTGG + Intergenic
986565777 5:9112473-9112495 TAGCAGTATGGCCCAGTAGAGGG - Intronic
989647131 5:43647065-43647087 AAGAATTAAGGACCAGCACCAGG + Intronic
991666231 5:69002474-69002496 TGGCAAAATGGACCAGCATCAGG - Intergenic
999366042 5:151024113-151024135 TAGCATTATAGACCAGGAGAGGG - Intronic
999750623 5:154625799-154625821 TAGCATTATGTACAAGAAGGAGG - Intergenic
1003189481 6:3861719-3861741 TTGCACTATGGAGCAGGAGCTGG + Intergenic
1003374213 6:5559866-5559888 TAGCACTATGGAACAGAGGCAGG + Intronic
1004036511 6:11929647-11929669 GTGCATCATGGAACAGCAGCTGG - Intergenic
1007917116 6:45571617-45571639 AAACATGAAGGACCAGCAGCAGG + Intronic
1009851326 6:69202974-69202996 TATGATTATGAACTAGCAGCTGG - Intronic
1013849256 6:114494221-114494243 TAGCATTTTGGTGCAACAGCTGG - Intergenic
1018408356 6:163512734-163512756 AAGCTTTATGGACCAGCACGTGG - Intronic
1029946588 7:104539641-104539663 TTTCATTATGGACCAGCATTTGG - Intronic
1030314234 7:108097910-108097932 TATCATAAAGGACCAGCAGGGGG - Intronic
1030866441 7:114706182-114706204 CCGCTTTATGTACCAGCAGCTGG + Intergenic
1043409125 8:79973735-79973757 TAGAACTTTGGAACAGCAGCAGG + Intronic
1044908724 8:97033440-97033462 TATCATTATAGACCAGAAGTAGG - Intronic
1051364151 9:16309242-16309264 TTTCGTTAGGGACCAGCAGCTGG - Intergenic
1056027329 9:82512624-82512646 TAGGTTTAAGGACCAGCATCAGG - Intergenic
1186680719 X:11870754-11870776 TAGCATCTTGGACCGGCAGTAGG + Intergenic
1192360499 X:70435755-70435777 TAGCATTCTGGCCCAGGAGTGGG - Intergenic
1195095984 X:101501576-101501598 TAGCATTCTGGAGCAGCAGAGGG + Intronic
1196993344 X:121352656-121352678 TTGCCTTATGGACCAGCATATGG - Intergenic
1200543075 Y:4483882-4483904 TAGCAGTGTTGACCAGCAGGGGG - Intergenic