ID: 1177792517

View in Genome Browser
Species Human (GRCh38)
Location 21:25735649-25735671
Sequence GGCCGCGGGGGGGCCCTTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 123}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177792517_1177792528 8 Left 1177792517 21:25735649-25735671 CCCACAAGGGCCCCCCCGCGGCC 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1177792528 21:25735680-25735702 GTTTTGTTTCCGCTGGTCCCCGG 0: 1
1: 0
2: 1
3: 6
4: 116
1177792517_1177792527 1 Left 1177792517 21:25735649-25735671 CCCACAAGGGCCCCCCCGCGGCC 0: 1
1: 0
2: 1
3: 14
4: 123
Right 1177792527 21:25735673-25735695 CCTCTGTGTTTTGTTTCCGCTGG 0: 1
1: 0
2: 0
3: 14
4: 167

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177792517 Original CRISPR GGCCGCGGGGGGGCCCTTGT GGG (reversed) Intronic
903263370 1:22142961-22142983 GGCCGCGGGGGGCCTCCCGTCGG + Exonic
903652444 1:24930156-24930178 GGCCGCGGCGGGGCCCGCGCGGG + Intronic
904036560 1:27562131-27562153 GGCCGAGGGGAGGCCTGTGTGGG + Intronic
909393086 1:75137016-75137038 GGCGGTGGGGGCGCCCTTGTGGG + Intronic
912812143 1:112802583-112802605 GGGCGGGGGGGGGCTCTTATGGG + Intergenic
914240455 1:145849520-145849542 GGCCCCTGGGGGGGCCTTGAGGG - Exonic
916108592 1:161447782-161447804 GGGCGCGGGGCGGCCTTTGGCGG - Intergenic
916110180 1:161455163-161455185 GGGCGCGGGGCGGCCTTTGGCGG - Intergenic
916111765 1:161462573-161462595 GGGCGCGGGGCGGCCTTTGGCGG - Intergenic
916113352 1:161469954-161469976 GGGCGCGGGGCGGCCTTTGGCGG - Intergenic
918015865 1:180632104-180632126 CGCCGCGCCGGGGCCCATGTGGG + Exonic
924242836 1:242057145-242057167 GGCGGTGGGGGGGCCCTTGAGGG + Intergenic
1065784621 10:29201900-29201922 GAGCTCGGGGGGGCCCTTGAAGG + Intergenic
1069474575 10:68721400-68721422 GGCGACGGTGGGGCTCTTGTGGG + Intronic
1071481023 10:86065089-86065111 GGCCGGGTGGTGGCCCTAGTGGG - Intronic
1075629463 10:123992243-123992265 GGCGGCGGGGGTGCCCATGAAGG + Intergenic
1075777832 10:124999496-124999518 GACCTAGGGGTGGCCCTTGTGGG - Intronic
1076677027 10:132152421-132152443 GGCCCCTGGGTGGCCCTTCTGGG - Intronic
1077635779 11:3840772-3840794 GGCCGCGGGCGGGAGCTTCTCGG - Intronic
1083316374 11:61817002-61817024 GCCCGCGAGGGGGCGCGTGTTGG - Exonic
1084592771 11:70100049-70100071 TGCGGCGTGGGGACCCTTGTAGG - Intronic
1084669195 11:70595300-70595322 GGCTGCGAGGGGGCGCTTGGAGG - Intronic
1084951479 11:72668572-72668594 GGCCGAGGGCCGGCCCTGGTGGG - Intronic
1084973051 11:72781740-72781762 GGCCGCGCGGGGGCTCTGGTGGG + Intronic
1091273102 11:134331845-134331867 GGCCGGGGCGGGGCCTCTGTCGG - Intergenic
1097176772 12:57147819-57147841 GGCCTCAGGGGGGCCCTCGGGGG - Intronic
1102269141 12:111516234-111516256 GGCCGCGAGGGGGGCCTGGAGGG + Exonic
1102785220 12:115599234-115599256 GGGCGCGAGGGGGGCCTTCTGGG + Intergenic
1104940041 12:132390739-132390761 GGCTGCAGGGTGGCCCTTGTTGG - Intergenic
1105054036 12:133080889-133080911 GCCCGCGGAGGGGCCCTGGGGGG + Exonic
1107389154 13:39945335-39945357 AGCCGGGGTGGGGCCCTGGTGGG - Intergenic
1113883863 13:113647160-113647182 GGGCACGGGGGTGCCCCTGTGGG + Intergenic
1113990215 14:16022856-16022878 GGCCACGGGCGGGTCCTCGTTGG + Intergenic
1113994129 14:16053027-16053049 GTCGACGGGGGGGCCCTTGTGGG + Intergenic
1117424516 14:55580520-55580542 TGCCGCCGCGGGGCTCTTGTTGG + Intronic
1122370255 14:101225583-101225605 GGCCCCCGGGGGGCCCTTGTGGG - Intergenic
1122921927 14:104883892-104883914 GGCCGCTGGGGTGCCCTTGGAGG + Exonic
1123173812 14:106399191-106399213 GGCCGCGTGGGGGCGCCTGCTGG - Intergenic
1123182065 14:106480465-106480487 GGCCGCGTGGGGGCGCCTGCTGG - Intergenic
1202944840 14_KI270726v1_random:16265-16287 GGCCGCGTGGGGGCGCCTGCTGG + Intergenic
1129152386 15:73697121-73697143 GGCCTCAGGGTGGCCCTTGTGGG + Intronic
1129256960 15:74339131-74339153 GGCCCTGGTGGGGCCCTTGATGG - Intronic
1132599952 16:768935-768957 GGCCAGGTGGGGGCCCTTGGAGG + Intergenic
1136586716 16:31191025-31191047 GGCCGCGGCGGGGACCGTGGAGG + Exonic
1137261011 16:46830600-46830622 GGTCGCGGAGGGGCCGTTTTGGG + Intronic
1139546737 16:67653189-67653211 GGCCGCGGCCGGGCCCGGGTCGG - Exonic
1141619293 16:85228291-85228313 GGCTGCTGGGGAGCCATTGTAGG + Intergenic
1141951630 16:87343606-87343628 GGCCGTGGTGGGGCCCTTTGTGG + Exonic
1143130588 17:4674640-4674662 GCCCGCGGGGGAGCCCTGATGGG - Exonic
1143634342 17:8155913-8155935 GGCCGGAGGGAGGCCCTGGTAGG - Intronic
1145041225 17:19579747-19579769 GGCACCGGGAGGGCCCTTGGGGG - Intergenic
1146183018 17:30709288-30709310 GGCAGCGGGGGCGCCCCTGCAGG - Intergenic
1147896554 17:43755327-43755349 GGGCGCGGGCGGGCTCTAGTAGG + Exonic
1148336054 17:46842010-46842032 GGCCGCGGTGGCGCCCTCGGCGG + Intronic
1150605476 17:66686898-66686920 GGCATCGTGTGGGCCCTTGTGGG - Intronic
1152552190 17:81035382-81035404 GGCCCCGGGGCCGCCCTGGTCGG - Intronic
1152555933 17:81053284-81053306 GGCCGGTGGGGGGCCCTTCTGGG + Intronic
1152612639 17:81323181-81323203 GGCCTCGGGGGAGCCCTGGACGG + Intronic
1152760677 17:82105650-82105672 GGCCCCGGGGCTGCCTTTGTGGG + Intronic
1152871076 17:82753214-82753236 GGCAGGGTGGGGGGCCTTGTGGG + Intronic
1154416373 18:14177982-14178004 GCCCGCGGCGGGGGACTTGTTGG + Intergenic
1155007500 18:21741513-21741535 TGCCGCCGGGGGGCCCGTGAGGG - Exonic
1157492957 18:48136821-48136843 GGCCGCGGGGCGGCTCTGGCTGG - Intronic
1158266407 18:55664913-55664935 GGCTGCGGGGGCGCGCTTGCGGG + Intergenic
1160349747 18:78166675-78166697 GGCCCCGGGGGGTCCCTGGATGG - Intergenic
1160554562 18:79717198-79717220 AGCCGGGTGGGGGCCCTGGTGGG + Intronic
1160807543 19:999125-999147 GGCCTCGGGGGGTGCCTTCTGGG - Intergenic
1160858173 19:1226667-1226689 GGGCGCGGCGGGGCCCGGGTGGG + Intronic
1161063435 19:2226534-2226556 GGCCGCCTCGGGGCCCTTGTGGG - Exonic
1161327505 19:3670760-3670782 GGCAGCGGGTGGGCCCTGGAGGG + Intronic
1162402155 19:10453030-10453052 TGCCGCGGGGGGGCCCGTTGGGG + Intronic
1163691981 19:18743192-18743214 GGCTGCGGGGGCACCCTGGTGGG - Intronic
1165149391 19:33751978-33752000 GGCAGCGGAGGGGCCCTGCTTGG + Intronic
1166882873 19:45939947-45939969 GGCCGCGGGGCTGCCCGTGATGG + Exonic
1168062100 19:53898779-53898801 GGCCGGGGGGGGGTCCTTGGGGG + Intronic
925413248 2:3652179-3652201 GGCAGCCGAGGGGCCCTTGCAGG - Intergenic
926280637 2:11442857-11442879 GGTGGGGGGGGGGCCCTTATAGG + Intergenic
928340037 2:30435095-30435117 AGCCGGGGAGGGGCCCTAGTGGG + Intergenic
932574334 2:72954564-72954586 GGGCCCTGGGGCGCCCTTGTAGG - Intronic
932836944 2:75046690-75046712 GGCGGTGGGGGGGCCTTTATCGG - Exonic
934978573 2:98822737-98822759 GGACGCGGCGGGGCCCTCGCTGG + Exonic
937976945 2:127588261-127588283 GGCCGTAGTGGGGCCATTGTAGG + Intronic
939092203 2:137792266-137792288 TGCCACGGGAGGGGCCTTGTGGG - Intergenic
942120677 2:172773636-172773658 GTCCGCGGGGGGGGCAGTGTGGG - Intronic
942505616 2:176638281-176638303 GGCGGCGCGGGCGCCCTTGCGGG + Intergenic
946306571 2:218859884-218859906 GGCGGCGGGGGGGCCCATCCCGG - Exonic
948674699 2:239590019-239590041 GGCCTCTGTGGGGACCTTGTGGG - Intergenic
948921019 2:241065937-241065959 GGCCGCGGGGGTGGGCTTGGGGG + Intronic
1170741836 20:19065252-19065274 TGCAGGGGTGGGGCCCTTGTGGG + Intergenic
1171813613 20:29764048-29764070 GGCCACGGGCGGGTCCTCGTCGG - Intergenic
1176109914 20:63406502-63406524 GGCCCTGGAGGGGCCCATGTGGG - Exonic
1176156831 20:63626467-63626489 GCCTGCGGGGTGGTCCTTGTGGG + Intronic
1176856958 21:13981284-13981306 GCCCGCGGCGGGGGACTTGTTGG - Intergenic
1177792517 21:25735649-25735671 GGCCGCGGGGGGGCCCTTGTGGG - Intronic
1178888211 21:36498827-36498849 GGCCGCTGAGGGGCCCTCATGGG + Intronic
1179504966 21:41834285-41834307 GGGCGCGGGGGGCCCTTGGTGGG - Intronic
1179881975 21:44296716-44296738 GGCCGTGTGGGGGCTCTTGTTGG - Intronic
1180259746 21:46661362-46661384 GGCCGCGCGGTGGCGCTCGTGGG + Intronic
1180313139 22:11254488-11254510 GTCGACGGGGGGGCCCTTGTGGG - Intergenic
1180317056 22:11284670-11284692 GGCCACGGGCGGGTCCTCGTTGG - Intergenic
1185058196 22:48592049-48592071 GGAGGCGGGGGGTCCCTTGCAGG + Intronic
1185188552 22:49418065-49418087 GGCCGCGCGGGTGCACGTGTGGG - Intronic
961827613 3:129606951-129606973 GGCCGCGGGCGGGTCCTGGAGGG - Intergenic
961946312 3:130692705-130692727 GGCCCCTGTGGGGCCCCTGTGGG - Intronic
968297184 3:197585706-197585728 GGCCTTGGGAGGGCCCATGTCGG + Intergenic
968612788 4:1564660-1564682 GGCTGAGGAGGGGGCCTTGTGGG + Intergenic
968618436 4:1592800-1592822 GGCCGCGGGGGCGCCTGAGTGGG + Intergenic
968835884 4:2963889-2963911 GGCGGCGGCGGCGCCCTTGGTGG + Exonic
985445142 4:190017603-190017625 GGCCGCGGGGGAGCGGTTCTGGG + Intergenic
985688504 5:1294544-1294566 GGCCTCGGGGGGGCCCCCGCGGG + Exonic
1001083977 5:168687032-168687054 GGCCCCGTGGCGGCACTTGTGGG + Exonic
1002186814 5:177458418-177458440 GGCGGCGGGGGGTACGTTGTTGG + Exonic
1012543749 6:100393586-100393608 GGCCGGGAGGGAGCCCTGGTGGG - Exonic
1016172903 6:141041697-141041719 GGCCGCGCGGGAGCCCATGGTGG + Intergenic
1017325129 6:153133909-153133931 GGCCGCAGGGGAGCCCATGGAGG - Intergenic
1019521376 7:1461915-1461937 GGCCGTGGGGTAGCCCTTGGTGG - Intergenic
1019701187 7:2475668-2475690 GGCCCCGGGGGAGCCCTTTGAGG - Exonic
1022103818 7:27184629-27184651 GGCCGCCGGGGGCCCCTTCTCGG + Exonic
1024464699 7:49700060-49700082 GGCAGCAGGAGGGGCCTTGTAGG + Intergenic
1025213190 7:57033090-57033112 GGCCGAGGGAGGGGCTTTGTGGG - Intergenic
1025658763 7:63543734-63543756 GGCCGAGGGAGGGGCTTTGTGGG + Intergenic
1028477261 7:91265578-91265600 GGGCGTCGGGGTGCCCTTGTCGG - Exonic
1029683400 7:102128360-102128382 GGCCGAGGGAGGGGCTTTGTGGG - Intronic
1029707315 7:102282786-102282808 GGCTGAGGGGGGGCCCAAGTGGG - Intronic
1033099841 7:138460602-138460624 GGCCTCCGGGGGGCCCTCGGCGG + Exonic
1034425783 7:151013457-151013479 GGCCACGGGAGGGCCGTGGTTGG - Intronic
1035397280 7:158543341-158543363 GCCGGCGGGGCGGCCGTTGTGGG - Intronic
1036733395 8:11285100-11285122 GGGAGCCGGGGGTCCCTTGTGGG + Intronic
1040296752 8:46152856-46152878 GGCCACAGGTGGGCCTTTGTGGG - Intergenic
1043035825 8:75197471-75197493 GGCCCCTGGGTGGCCCTTGCTGG - Intergenic
1049684014 8:143932083-143932105 GGCTGCGGGGGGGGCCGTGCCGG - Intronic
1050294955 9:4195578-4195600 GGCCGCGTGGGAGCCCGTGGAGG - Intronic
1057245800 9:93452615-93452637 GGCCGCGTGGGGACACTTGAGGG + Exonic
1057708078 9:97412156-97412178 GGCCGCGGCGGGGCCCCTGGCGG + Exonic
1057886453 9:98833519-98833541 GGCCCTGGGGGGACCGTTGTAGG + Intronic
1061928745 9:133821297-133821319 GGCCGCAGTGGGTCTCTTGTTGG + Intronic
1062255454 9:135618717-135618739 GGCAGTGGGTGGGGCCTTGTGGG + Intergenic
1203365292 Un_KI270442v1:250369-250391 GGCCACGGGCGGGTCCTCGTCGG - Intergenic
1194781275 X:98028317-98028339 GGGAGTGGGGGGGCCCTTGCTGG + Intergenic