ID: 1177793714 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 21:25749668-25749690 |
| Sequence | CTAAAAATACAGAATAAGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 47143 | |||
| Summary | {0: 4, 1: 178, 2: 8834, 3: 22823, 4: 15304} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1177793708_1177793714 | 7 | Left | 1177793708 | 21:25749638-25749660 | CCTGGCCAACATGGTGCAACCCC | 0: 179 1: 65909 2: 152622 3: 198051 4: 161154 |
||
| Right | 1177793714 | 21:25749668-25749690 | CTAAAAATACAGAATAAGCTGGG | 0: 4 1: 178 2: 8834 3: 22823 4: 15304 |
||||
| 1177793709_1177793714 | 2 | Left | 1177793709 | 21:25749643-25749665 | CCAACATGGTGCAACCCCATCTC | 0: 108 1: 40542 2: 96506 3: 131605 4: 108113 |
||
| Right | 1177793714 | 21:25749668-25749690 | CTAAAAATACAGAATAAGCTGGG | 0: 4 1: 178 2: 8834 3: 22823 4: 15304 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1177793714 | Original CRISPR | CTAAAAATACAGAATAAGCT GGG | Intronic | ||
| Too many off-targets to display for this crispr | |||||