ID: 1177793714

View in Genome Browser
Species Human (GRCh38)
Location 21:25749668-25749690
Sequence CTAAAAATACAGAATAAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 47143
Summary {0: 4, 1: 178, 2: 8834, 3: 22823, 4: 15304}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177793708_1177793714 7 Left 1177793708 21:25749638-25749660 CCTGGCCAACATGGTGCAACCCC 0: 179
1: 65909
2: 152622
3: 198051
4: 161154
Right 1177793714 21:25749668-25749690 CTAAAAATACAGAATAAGCTGGG 0: 4
1: 178
2: 8834
3: 22823
4: 15304
1177793709_1177793714 2 Left 1177793709 21:25749643-25749665 CCAACATGGTGCAACCCCATCTC 0: 108
1: 40542
2: 96506
3: 131605
4: 108113
Right 1177793714 21:25749668-25749690 CTAAAAATACAGAATAAGCTGGG 0: 4
1: 178
2: 8834
3: 22823
4: 15304

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177793714 Original CRISPR CTAAAAATACAGAATAAGCT GGG Intronic
Too many off-targets to display for this crispr