ID: 1177797093

View in Genome Browser
Species Human (GRCh38)
Location 21:25790276-25790298
Sequence TGGCATACAGCAGCGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177797082_1177797093 25 Left 1177797082 21:25790228-25790250 CCAACTTGTTCCAGTTGATGTCA No data
Right 1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG No data
1177797084_1177797093 15 Left 1177797084 21:25790238-25790260 CCAGTTGATGTCACTATGGCAAA No data
Right 1177797093 21:25790276-25790298 TGGCATACAGCAGCGGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177797093 Original CRISPR TGGCATACAGCAGCGGGGGA AGG Intergenic
No off target data available for this crispr