ID: 1177797093 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 21:25790276-25790298 |
Sequence | TGGCATACAGCAGCGGGGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1177797082_1177797093 | 25 | Left | 1177797082 | 21:25790228-25790250 | CCAACTTGTTCCAGTTGATGTCA | No data | ||
Right | 1177797093 | 21:25790276-25790298 | TGGCATACAGCAGCGGGGGAAGG | No data | ||||
1177797084_1177797093 | 15 | Left | 1177797084 | 21:25790238-25790260 | CCAGTTGATGTCACTATGGCAAA | No data | ||
Right | 1177797093 | 21:25790276-25790298 | TGGCATACAGCAGCGGGGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1177797093 | Original CRISPR | TGGCATACAGCAGCGGGGGA AGG | Intergenic | ||
No off target data available for this crispr |