ID: 1177801025

View in Genome Browser
Species Human (GRCh38)
Location 21:25828906-25828928
Sequence CTGAATAATTGGTTGGAGTA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177801025_1177801030 2 Left 1177801025 21:25828906-25828928 CCCTACTCCAACCAATTATTCAG No data
Right 1177801030 21:25828931-25828953 TGTCTCATTTGATAGCCTCAGGG No data
1177801025_1177801029 1 Left 1177801025 21:25828906-25828928 CCCTACTCCAACCAATTATTCAG No data
Right 1177801029 21:25828930-25828952 TTGTCTCATTTGATAGCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177801025 Original CRISPR CTGAATAATTGGTTGGAGTA GGG (reversed) Intergenic
No off target data available for this crispr