ID: 1177807631

View in Genome Browser
Species Human (GRCh38)
Location 21:25889595-25889617
Sequence CCGCCCTCCCCAACCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2326
Summary {0: 1, 1: 0, 2: 23, 3: 326, 4: 1976}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177807631_1177807634 -7 Left 1177807631 21:25889595-25889617 CCTTGGGAGGTTGGGGAGGGCGG 0: 1
1: 0
2: 23
3: 326
4: 1976
Right 1177807634 21:25889611-25889633 AGGGCGGATCACTTGAGGCCAGG 0: 50
1: 1646
2: 17594
3: 81020
4: 177055
1177807631_1177807637 20 Left 1177807631 21:25889595-25889617 CCTTGGGAGGTTGGGGAGGGCGG 0: 1
1: 0
2: 23
3: 326
4: 1976
Right 1177807637 21:25889638-25889660 CAAGACCAGCCTGGCCAACATGG 0: 36878
1: 108443
2: 168596
3: 179002
4: 104175
1177807631_1177807636 11 Left 1177807631 21:25889595-25889617 CCTTGGGAGGTTGGGGAGGGCGG 0: 1
1: 0
2: 23
3: 326
4: 1976
Right 1177807636 21:25889629-25889651 CCAGGAATTCAAGACCAGCCTGG 0: 1413
1: 22759
2: 95221
3: 162970
4: 182028

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177807631 Original CRISPR CCGCCCTCCCCAACCTCCCA AGG (reversed) Intronic
Too many off-targets to display for this crispr