ID: 1177808036

View in Genome Browser
Species Human (GRCh38)
Location 21:25894493-25894515
Sequence ACAATGATTCCAACTCTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 176}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177808031_1177808036 19 Left 1177808031 21:25894451-25894473 CCATGGGAGATCAAAACATCAGC 0: 1
1: 0
2: 1
3: 5
4: 154
Right 1177808036 21:25894493-25894515 ACAATGATTCCAACTCTCATGGG 0: 1
1: 0
2: 2
3: 11
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177808036 Original CRISPR ACAATGATTCCAACTCTCAT GGG Intronic
903733814 1:25517300-25517322 ACAATGAAGCCAACACTCAAAGG - Intergenic
908869886 1:68597398-68597420 AACTTGATTCCAACACTCATGGG + Intergenic
908874696 1:68659485-68659507 CCAATTATTACAACTCTAATAGG - Intergenic
909459219 1:75890975-75890997 CTAATGATTCCCACTTTCATTGG - Intronic
910387495 1:86701402-86701424 ACTATGATTCAAATTCTCAAGGG - Intergenic
912876857 1:113368773-113368795 AATTTGATTCCAACTCTCATGGG + Intergenic
913411729 1:118559552-118559574 ATAATGATAACAACTCACATTGG + Intergenic
913584689 1:120262705-120262727 CCAATGATTCCAAAGCTCTTGGG + Intergenic
913623494 1:120635654-120635676 CCAATGATTCCAAAGCTCTTGGG - Intergenic
913679521 1:121175582-121175604 AAGTTGATTCCAACCCTCATGGG + Intronic
914031354 1:143963228-143963250 AAGTTGATTCCAACCCTCATGGG + Intronic
914158092 1:145104735-145104757 AAGTTGATTCCAACCCTCATGGG - Intronic
914566686 1:148874561-148874583 CCAATGATTCCAAAGCTCTTGGG + Intronic
914606133 1:149255679-149255701 CCAATGATTCCAAAGCTCTTGGG - Intergenic
917318697 1:173756735-173756757 GCAATGATACCAATTCACATAGG - Intronic
917345891 1:174027850-174027872 AGAATGATTTTAACTCTCAGAGG - Intergenic
920466826 1:206194127-206194149 AAGTTGATTCCAACCCTCATGGG + Intronic
921609711 1:217196770-217196792 AAGCTGATTCCAACTCTCATGGG - Intergenic
924168711 1:241313839-241313861 AAGTTGATTCCAACCCTCATGGG + Intronic
1064352616 10:14590439-14590461 ATATTGATTCTAACTATCATGGG - Intronic
1065779279 10:29151662-29151684 ACAATGATTCCAAGTATCACTGG + Intergenic
1070984473 10:80676749-80676771 AAGTTGCTTCCAACTCTCATAGG + Intergenic
1071741976 10:88369517-88369539 CCCCTGGTTCCAACTCTCATGGG + Intronic
1072850458 10:98885111-98885133 AAATTGATTCCAACCCTTATTGG + Intronic
1073404667 10:103286803-103286825 ACCATGAGTCCAAATCTCCTGGG + Intronic
1073492375 10:103861767-103861789 TCCATGATTCCAACTCTCCTTGG - Intergenic
1076488322 10:130838691-130838713 ACAATGATTGCTGCTCACATTGG + Intergenic
1078951109 11:16135490-16135512 AAGTTGATTCCAACCCTCATGGG + Intronic
1085658388 11:78338824-78338846 ACAATGACTCCAAATTTCACTGG + Intronic
1085724932 11:78946738-78946760 AAACTGATTCCAGCTCTCACGGG + Intronic
1085828605 11:79874996-79875018 AAGTTGATTCCAACTCTCATTGG - Intergenic
1087176035 11:95096805-95096827 ACAAAAATACCTACTCTCATAGG + Intronic
1089724276 11:120461068-120461090 AAGTTGATTCCAACCCTCATAGG - Intronic
1090009209 11:123031015-123031037 ATAATGATGCTAACCCTCATTGG + Intergenic
1090462635 11:126905711-126905733 ACAACAATTCCATCTCACATAGG - Intronic
1099801260 12:87459960-87459982 ACAATGACATCAAATCTCATGGG + Intergenic
1100041949 12:90330555-90330577 ACAGTGCTTCCAATTCTAATTGG - Intergenic
1101062389 12:100985743-100985765 ACCATGATCCCAACTCTGCTTGG - Intronic
1104223139 12:126805482-126805504 ACACCTATTCCCACTCTCATGGG - Intergenic
1105825469 13:24118862-24118884 ACAAAGATTCCAACTCTGTCAGG + Intronic
1108019827 13:46116329-46116351 TCAATGATTCAAACTGTCAAAGG + Intergenic
1108353642 13:49610084-49610106 ACAAAGATGCCACCTCTCAATGG - Intergenic
1108611744 13:52090641-52090663 AAAATGATTCCAACACCCAGGGG + Intronic
1109232034 13:59769202-59769224 ACATTAATTCCTACTCTCCTAGG - Intronic
1111597448 13:90428898-90428920 TCAATTATTGCAACTGTCATGGG - Intergenic
1114026327 14:18530286-18530308 ACAAACATTCAGACTCTCATAGG - Intergenic
1114390709 14:22304885-22304907 ATAATGATTCCATATTTCATAGG - Intergenic
1117876215 14:60252255-60252277 AAAATTAATCCAGCTCTCATGGG - Intronic
1119157266 14:72422669-72422691 ATAATGACACCCACTCTCATGGG - Intronic
1120377923 14:83733121-83733143 ACCATGATTCCAAGTTTCCTGGG + Intergenic
1120416719 14:84228468-84228490 ACAATGTTTACAACTCTCTTGGG + Intergenic
1120484345 14:85092233-85092255 AGAATGATGACAACTCACATTGG - Intergenic
1120506626 14:85360949-85360971 ACAATTATTCCAGCTCTACTAGG + Intergenic
1120544225 14:85790735-85790757 AAGTTGATTCCAACTGTCATGGG + Intergenic
1122335095 14:100969541-100969563 ACACTGATTACTACTCACATTGG - Intergenic
1123818328 15:24001545-24001567 ACTATAATTTCAGCTCTCATGGG + Intergenic
1125451849 15:39816723-39816745 ACAATGATTCTAACTATGCTTGG + Intronic
1126419455 15:48455957-48455979 AAAATTATTCCAACTATCCTGGG + Intronic
1130048018 15:80461187-80461209 ACATTGATGCCACCTCACATTGG - Intronic
1131546881 15:93322965-93322987 AGTCTGCTTCCAACTCTCATGGG + Intergenic
1135343080 16:21665233-21665255 TAAATGATTCCAACGCTCACTGG - Intergenic
1137045011 16:35647508-35647530 ACAATGATGAACACTCTCATTGG + Intergenic
1138260984 16:55622396-55622418 ACAGTGAGTCCAACTGCCATTGG - Intergenic
1139611452 16:68061825-68061847 GCAATGATGGCAGCTCTCATTGG - Intronic
1145716448 17:27027582-27027604 ATGTTGATTCCATCTCTCATAGG - Intergenic
1146578842 17:34018651-34018673 AAGTTGATTCCAACCCTCATGGG + Intronic
1147918920 17:43904630-43904652 ACAATGATTCCAACGGTCCTGGG + Intronic
1148246890 17:46038121-46038143 ACACTGCTTCCAACGCCCATGGG + Intronic
1150031507 17:61741322-61741344 TCATTGATTCCATCCCTCATTGG - Intronic
1152108444 17:78343732-78343754 ACACTGGTTCCCACGCTCATAGG - Intergenic
1154471188 18:14703347-14703369 AAGTTGATTCCATCTCTCATAGG + Intergenic
1154954345 18:21241155-21241177 ACAATGATTCCAACCCACCCGGG + Intergenic
1156711484 18:39952003-39952025 AAGCTGATTCCAACCCTCATAGG - Intergenic
1157958131 18:52121908-52121930 ACAATCCTGCCAACTCTCAGTGG + Intergenic
1158392765 18:57057181-57057203 ACCATGTTTTCAACTCTCTTGGG + Intergenic
1158814620 18:61079806-61079828 ACATAGATTCCACCTCTTATTGG - Intergenic
1160250310 18:77197822-77197844 ACAATGATTGCCATTGTCATCGG - Intergenic
1167373433 19:49098436-49098458 ACAATGATCCCAATGCTCAGGGG + Exonic
926797130 2:16628242-16628264 AAAATGATACCAACTCTGAGAGG + Intronic
933906417 2:86898080-86898102 AAGTTGATTCCAACCCTCATGGG + Intergenic
934025053 2:87995569-87995591 AACTTGATTCCAACCCTCATGGG - Intergenic
935776131 2:106473664-106473686 AAGTTGATTCCAACCCTCATGGG - Intergenic
936365750 2:111853602-111853624 AAGTTGATTCCAACCCTCATGGG - Intronic
939722619 2:145673913-145673935 AAGTTGATTCCAACCCTCATTGG - Intergenic
939727379 2:145739404-145739426 AAAATGTGTCCAAATCTCATGGG - Intergenic
942311206 2:174658575-174658597 ACTATGATTCCAAGTCACTTGGG - Intronic
942796434 2:179825921-179825943 ACAATGATTCCTAGAATCATGGG - Intronic
943504211 2:188732687-188732709 AGACTAATTCCAACTCTGATGGG - Intergenic
944035361 2:195288929-195288951 AGAATGGTTTCAACTCTTATTGG - Intergenic
946783393 2:223216888-223216910 GCAATGATCTCCACTCTCATAGG - Intergenic
946913763 2:224493590-224493612 TCAATGATTCCAAGTCAGATGGG + Intronic
948721241 2:239901811-239901833 AAGTTGATTCCAACCCTCATAGG + Intronic
1169025881 20:2370909-2370931 AGAATGTTTCAAACTCTCAAGGG - Intergenic
1173467992 20:43299478-43299500 ACAATGCTACCAACTCTAACAGG - Intergenic
1176803301 21:13454593-13454615 AAGTTGATTCCATCTCTCATAGG - Intergenic
1177583663 21:23061139-23061161 ACACTGATTGGAAATCTCATTGG - Intergenic
1177808036 21:25894493-25894515 ACAATGATTCCAACTCTCATGGG + Intronic
1178176995 21:30113660-30113682 GGATTGATTCCAACCCTCATGGG - Intergenic
1182377988 22:29862357-29862379 ACAATGCTTCCAACTTTACTAGG + Intergenic
1182513013 22:30832614-30832636 ACAATGATTCCAACTGTGAGCGG - Intronic
1184011303 22:41750692-41750714 AGAAGAATTCCAACTCACATGGG - Intronic
949652273 3:6173684-6173706 GCAATGATACCAAATCTCAGTGG - Intergenic
950271260 3:11617132-11617154 ACAATAATTCTAACTCTAACAGG + Intronic
951662866 3:25089446-25089468 TCAATGCTTTCAACTCTCTTTGG - Intergenic
959343508 3:105161977-105161999 TCAATGAGGCCCACTCTCATTGG + Intergenic
961200356 3:125040631-125040653 ACAAAGAAACCCACTCTCATAGG - Intronic
962202207 3:133410476-133410498 CCAGTCATTCCAGCTCTCATGGG + Intronic
964076510 3:152699481-152699503 AAATTGATTCCAACCTTCATGGG - Intergenic
964136673 3:153352228-153352250 GCAATTATTAAAACTCTCATAGG + Intergenic
964942248 3:162173331-162173353 AAGTTGATTCTAACTCTCATAGG + Intergenic
965240673 3:166192915-166192937 ACAAATATGCCAACACTCATTGG - Intergenic
965931459 3:174048388-174048410 CCAATGATTTCACCTCTCACGGG - Intronic
970390308 4:15603043-15603065 AAGTTGATTCCAACTCTCAATGG - Intergenic
972282470 4:37616217-37616239 TCAATGATTCCTATTTTCATAGG + Intronic
976433051 4:84985950-84985972 AAGTTGATTCCAACCCTCATGGG + Intergenic
976777347 4:88720962-88720984 AGACTGTCTCCAACTCTCATGGG - Intergenic
977359724 4:95986701-95986723 CCGATTATTCAAACTCTCATTGG - Intergenic
980081739 4:128351369-128351391 ACAAGAATTCCAAATCTCAGTGG - Intergenic
980522306 4:133950033-133950055 AGAATGAATCAAACTCTCAAAGG - Intergenic
981119495 4:141033443-141033465 AAGTTGATTCCAATTCTCATGGG - Intronic
982578049 4:157142458-157142480 GCAATGATTCTAAATCACATTGG + Intronic
986257491 5:6112339-6112361 AGAGTGATCCCAACTCTCAGTGG + Intergenic
986738755 5:10687461-10687483 AAGCTGATTCCAACCCTCATGGG + Intronic
988217243 5:28290868-28290890 AAAAAGGTTCCAACCCTCATAGG - Intergenic
989287412 5:39718371-39718393 AAGTTGATTCCAACCCTCATGGG - Intergenic
990052210 5:51517686-51517708 TCATTCATTCCGACTCTCATAGG - Intergenic
991919265 5:71638320-71638342 AAGTTGATTCCAACCCTCATGGG - Intronic
991973262 5:72161310-72161332 ACATTGATTCCATTTCTCAATGG - Intronic
992728911 5:79638359-79638381 AAAATGATTCTGACTCTCAGTGG - Intronic
992820941 5:80495459-80495481 AAGTTGATTCCAGCTCTCATGGG + Intronic
993161092 5:84292525-84292547 GCAATGATACAAACTCTCAATGG + Intronic
994728668 5:103465737-103465759 AAAATGATGCCTGCTCTCATCGG - Intergenic
995214286 5:109577132-109577154 AAGCTGATTCCAACCCTCATGGG - Intergenic
995433163 5:112105144-112105166 ACAATGATTGCCCATCTCATAGG + Intergenic
996488923 5:124069083-124069105 ACAATGATACAAAGTATCATTGG - Intergenic
998942375 5:147298455-147298477 AGAATGATTCCAACTGACAATGG - Intronic
1000278048 5:159756817-159756839 AAATAGATTCCAACTCTCAATGG - Intergenic
1000386772 5:160682005-160682027 ACACTGATGCCAACTGTCATTGG + Intronic
1000811006 5:165861603-165861625 ACAAAGAAGCCAACTATCATTGG - Intergenic
1001373232 5:171228279-171228301 AAGTTGATTCCAACCCTCATGGG + Intronic
1003660129 6:8052497-8052519 AAGTTGATTCCAACCCTCATGGG + Intronic
1004930166 6:20455393-20455415 AGATTGATTCCAACCCTCTTTGG + Intronic
1006002770 6:30978539-30978561 ACCATGGTTCCAACTCTTGTGGG + Intergenic
1007126333 6:39428899-39428921 AGCATGTTTCCAACTCTCCTTGG + Intronic
1008197585 6:48543381-48543403 AAATTGATTTTAACTCTCATGGG - Intergenic
1011985570 6:93439784-93439806 ACACTGACTCCATCTCTCAATGG - Intergenic
1012012814 6:93812014-93812036 AAGTTGATTCCAACCCTCATAGG + Intergenic
1012084245 6:94803416-94803438 ACATATATTCCAACCCTCATGGG + Intergenic
1012091376 6:94902364-94902386 ATAAGGACTGCAACTCTCATAGG + Intergenic
1012217529 6:96605998-96606020 ACAATAATTGCCACTCTCTTTGG - Exonic
1012487563 6:99739127-99739149 ACAATCATTCCAAATCTTAGGGG - Intergenic
1014076568 6:117242128-117242150 AAGTTGATTCCAACCCTCATGGG + Intergenic
1015840034 6:137467188-137467210 ACATAGATCCCAACTCTCCTTGG - Intergenic
1016848144 6:148589632-148589654 AAGTTGATTCCAACCCTCATAGG + Intergenic
1018576050 6:165261513-165261535 ACAATGGTACCTACTCTTATGGG + Intergenic
1018691625 6:166349620-166349642 AAGTTGATTCCAACCCTCATGGG - Intergenic
1018697479 6:166401583-166401605 AAAAGGATTGCAACTCTCAGGGG + Intergenic
1018843503 6:167536707-167536729 AAGCTGATTCCAGCTCTCATGGG - Intergenic
1021282935 7:18742446-18742468 ACAATGATTCCACACTTCATAGG + Intronic
1022930741 7:35111068-35111090 AAAATGATTCCAACCCTCATGGG + Intergenic
1026384337 7:69831123-69831145 ACAAGGATTCCAACCTTCTTGGG - Intronic
1026467830 7:70669704-70669726 ACGATGACTTCAACTCTCAAAGG - Intronic
1028039921 7:86038712-86038734 ACAAAGTTTCCAAATCTCCTGGG + Intergenic
1028932149 7:96425418-96425440 GCAATAATTCCAACCTTCATAGG - Intergenic
1029826641 7:103203598-103203620 AAAATGATTCCAACCCTCATGGG + Intergenic
1031894209 7:127329391-127329413 ACAATCATTACAACACTCATTGG + Intergenic
1032252385 7:130269536-130269558 ACAATGATTCCAAAACTTGTGGG + Intronic
1035867139 8:3097074-3097096 AAAATGATTCCAACTGCAATAGG + Intronic
1038054870 8:23848876-23848898 ACAAAGCTTCCAACTCTCTAGGG - Intronic
1038079769 8:24120873-24120895 TCAATGATATCAACTCTTATAGG - Intergenic
1039212160 8:35229826-35229848 AAATTTATTCCAACCCTCATGGG - Intergenic
1041816519 8:61978389-61978411 CAAAAGTTTCCAACTCTCATTGG - Intergenic
1042236166 8:66614851-66614873 ACAGTGATTCCAAATGACATTGG - Intergenic
1042607574 8:70561446-70561468 ACAAGTATCCCTACTCTCATTGG - Intergenic
1042882293 8:73507071-73507093 AAGTTGATTCCAACCCTCATGGG - Intronic
1045419327 8:101998599-101998621 ATCATGATTACAACCCTCATGGG + Intronic
1045541682 8:103092559-103092581 AAATTGATTCTAACCCTCATGGG - Intergenic
1047009797 8:120659515-120659537 AAGTTGATTCCAACCCTCATGGG - Intronic
1047053031 8:121134470-121134492 ACAATGTCTCCATCTCTCCTGGG - Intergenic
1052001190 9:23283241-23283263 ACAATGCTTCCAACTTAAATAGG + Intergenic
1185851052 X:3489086-3489108 ACAATAATGCAAACCCTCATGGG - Intergenic
1186232829 X:7474269-7474291 ACATTGATTCAAACTCACAGGGG + Intergenic
1186303993 X:8234070-8234092 AAATTGATTCCAACCCTCATGGG - Intergenic
1188139381 X:26529639-26529661 AGGTTGATTCCAACCCTCATGGG + Intergenic
1192789886 X:74371130-74371152 ACAAAGATTTAAACTCTGATGGG - Intergenic
1194424622 X:93721317-93721339 ACAATGCTTCCTTTTCTCATGGG - Intergenic
1197893389 X:131287369-131287391 ACAATGATTTAAACTCCCAGAGG + Intronic
1198493653 X:137168626-137168648 TCAATGGTTCCAAATGTCATGGG - Intergenic
1199361020 X:146919034-146919056 AAAATGTTTTCACCTCTCATTGG + Intergenic
1199574411 X:149299580-149299602 ACCATGATTGCAACTTTCCTGGG + Intergenic