ID: 1177809054

View in Genome Browser
Species Human (GRCh38)
Location 21:25905231-25905253
Sequence CCGAGCATCGAGGACCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177809048_1177809054 -7 Left 1177809048 21:25905215-25905237 CCACAGTGAGTTAATCCCGAGCA 0: 1
1: 0
2: 0
3: 6
4: 45
Right 1177809054 21:25905231-25905253 CCGAGCATCGAGGACCAGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 92
1177809047_1177809054 4 Left 1177809047 21:25905204-25905226 CCAGAAAAGAACCACAGTGAGTT 0: 1
1: 0
2: 1
3: 22
4: 234
Right 1177809054 21:25905231-25905253 CCGAGCATCGAGGACCAGGAGGG 0: 1
1: 0
2: 0
3: 10
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177809054 Original CRISPR CCGAGCATCGAGGACCAGGA GGG Intronic
900334409 1:2154399-2154421 CCAAGCCTCGAGGAGGAGGAGGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
906244683 1:44264624-44264646 GCCAGCATCGAGGACAAGGACGG + Intronic
906607041 1:47179941-47179963 ACAAGCATCGAGGAGCAGGCTGG + Intergenic
912332838 1:108835011-108835033 CTGAGCCTCGAGGCCCAGAAGGG + Exonic
913070488 1:115293866-115293888 ACCAGCATCAAGGCCCAGGAAGG + Intronic
914448628 1:147771737-147771759 CAGAGCAGAGAGTACCAGGAGGG - Intronic
914510852 1:148330595-148330617 CCCAGCAGGGAGGAGCAGGAAGG - Intergenic
915112444 1:153572750-153572772 GCCAGCATAGAGGACCAAGAAGG + Intergenic
915495591 1:156280527-156280549 CCTGGCATCGAGGGCCAGGTTGG - Intronic
1069044190 10:63724721-63724743 ACAAGCATTGAGGAGCAGGAGGG + Intergenic
1069869650 10:71525518-71525540 CAGAGCATCCAGGACTAGGGAGG + Intronic
1070594754 10:77824721-77824743 CAGAACACCGAGGACCCGGAGGG + Intronic
1071568118 10:86681843-86681865 CCGAGCACCGAGGACCCAGGTGG - Intronic
1076181858 10:128415553-128415575 ACGAGCCTAGAGGAGCAGGAGGG + Intergenic
1084569378 11:69950336-69950358 CCAAGCATGGGGCACCAGGAGGG - Intergenic
1088811282 11:113394452-113394474 CCATGCATTGAGGGCCAGGAAGG - Intronic
1097823124 12:64147441-64147463 CTGAGCACCGAGGCACAGGAAGG - Exonic
1104975649 12:132550868-132550890 CCGGGCAGAGAAGACCAGGAGGG - Intronic
1106173331 13:27307862-27307884 CCCACCATCGTGGTCCAGGATGG + Intergenic
1107467478 13:40664576-40664598 TTGAGCATGGAGGACCAGGCGGG - Intronic
1121419478 14:93802604-93802626 CCCAGAATCGAGGCACAGGAAGG - Intergenic
1122404266 14:101490575-101490597 TGGGGCATGGAGGACCAGGAGGG + Intergenic
1122688799 14:103522078-103522100 CCCATCATCGAGGACCGGCACGG - Exonic
1124593796 15:31077387-31077409 CTGAGCATCCAGCACCAGCAGGG - Intronic
1126064927 15:44819396-44819418 CCAAACCTCGAGGACCAGGAGGG - Intergenic
1126172654 15:45707288-45707310 CCCAGCATCAAGGCCCAGTAAGG - Intergenic
1127992410 15:64130435-64130457 CAGAACATCAAGGACCAGGTGGG - Intronic
1132395295 15:101468693-101468715 CCCAGCATCAAGGACGTGGATGG - Intronic
1132572382 16:649673-649695 CCGGGCCTCGGGGACCAGGCAGG - Intronic
1137977200 16:53041958-53041980 CAGAGCCTGGAGGAGCAGGAGGG - Intergenic
1139511830 16:67432133-67432155 CTGGGCACAGAGGACCAGGAGGG - Intronic
1142695690 17:1631757-1631779 TGGAGCATCGGGGACCAGGCAGG - Intergenic
1144807223 17:17976091-17976113 CCTAGCATCAGGGACCAGCAGGG + Intronic
1145828516 17:27896062-27896084 CATAGTATGGAGGACCAGGAAGG - Intergenic
1147996615 17:44363299-44363321 CAGCGCCTCGCGGACCAGGAGGG + Intronic
1150002788 17:61452072-61452094 CCGAGGCTCGACAACCAGGAGGG - Intergenic
1152037042 17:77880039-77880061 CCCAGCAGCGAGGTTCAGGAGGG - Intergenic
1152896469 17:82914217-82914239 CAGAGCACCGAGAACCCGGATGG - Intronic
1155083604 18:22433972-22433994 CAGAGCATCAAGTAACAGGATGG - Intergenic
1168371281 19:55836531-55836553 CCAATCATTAAGGACCAGGAAGG + Intronic
1168486249 19:56764834-56764856 CCGATCGTGGAGGACCTGGAGGG - Intergenic
928922975 2:36544706-36544728 CTGAGCACAGAGGGCCAGGAAGG - Intronic
931223205 2:60306821-60306843 CCAAGCCTATAGGACCAGGAAGG - Intergenic
933727597 2:85435558-85435580 CCGAGCAGTGGGGAGCAGGAGGG + Intronic
935840154 2:107100391-107100413 CTGAGCATCCAGCACCAGGCAGG - Intergenic
936524100 2:113231296-113231318 CAGAGCAGCTGGGACCAGGACGG + Intronic
939960389 2:148560742-148560764 CCCAGCCTCTAGGACCAGGGCGG + Intergenic
948384979 2:237575632-237575654 CTGAGCAGCCAGGACCAGGGAGG + Intronic
1172870538 20:38132786-38132808 CCAAACATCGAGGACCTGGGAGG - Intronic
1173750116 20:45469898-45469920 CCGAGCCACGAGCGCCAGGATGG + Intronic
1173824664 20:46040557-46040579 CCCAGCATAGATGGCCAGGATGG - Exonic
1176155216 20:63616533-63616555 CCCAGAAGCGAGGAGCAGGAGGG + Intronic
1177809054 21:25905231-25905253 CCGAGCATCGAGGACCAGGAGGG + Intronic
1179172598 21:38984149-38984171 CCGAGCTGCCAGGACCAGGCTGG + Intergenic
1179803771 21:43824563-43824585 GCGAGAATCGAGGACCCGGAAGG - Intergenic
1181014924 22:20063351-20063373 CCGGCCATCGAGGACCAGGGTGG + Exonic
1182029068 22:27143399-27143421 CCAAGCATAGAGGAGCAGGGTGG - Intergenic
1182286182 22:29249273-29249295 CCGAGGCTGGAGCACCAGGACGG + Intronic
1184759233 22:46535555-46535577 CTGAGCATTAAGGCCCAGGATGG - Exonic
1184865336 22:47199040-47199062 CTGAGCATGGAGGGCCAGGAAGG - Intergenic
1185130235 22:49034883-49034905 CTGTGCATAGAGGAACAGGATGG + Intergenic
949394696 3:3602476-3602498 CCAAGCATGGATGTCCAGGAGGG - Intergenic
950727500 3:14926476-14926498 CCCAGCATCTAGGACAAAGATGG + Intronic
951390180 3:22093005-22093027 CCCAGCATCCAGGAGCAGGAAGG + Intronic
952211210 3:31231138-31231160 CAGAGCAGGGAGGACAAGGAGGG + Intergenic
954304176 3:49716878-49716900 TGGAGCAGCGAGGTCCAGGATGG + Exonic
954314653 3:49794624-49794646 GCCACCATCGAGCACCAGGATGG + Exonic
955966874 3:64397840-64397862 CCCAGCATCCAGGGCCAGGCTGG + Intronic
956255160 3:67275629-67275651 CAGAGCAACCAGGACCAGGGTGG + Intergenic
957589738 3:82180536-82180558 CCAAGCATTCAGGACCAGCATGG - Intergenic
960990114 3:123304661-123304683 CTGACCAGCGAGGAGCAGGAAGG + Intronic
963828072 3:149977051-149977073 CTGAGCATTGTGGAGCAGGAGGG + Intronic
969449173 4:7263359-7263381 CCCAGCCTGGAGGAGCAGGAAGG + Intronic
970862975 4:20724504-20724526 AAGAGCATTGAGGACCATGATGG - Intronic
979357682 4:119724645-119724667 CAGAGGATCGAGAGCCAGGAGGG + Intergenic
992762529 5:79963123-79963145 CAGAGAAGCGAGGACCAGGTGGG + Intergenic
993807177 5:92425344-92425366 TCAAGCATGGAGAACCAGGACGG - Intergenic
1001304304 5:170560559-170560581 CCGGGGATCAGGGACCAGGATGG + Intronic
1002420900 5:179148659-179148681 CCGAGCGAGGAGGACCAGGAAGG - Intronic
1005495041 6:26381089-26381111 CAGAAGATCAAGGACCAGGAAGG - Intergenic
1014268976 6:119314655-119314677 CTGTGCATGGAGGAGCAGGAGGG - Intronic
1023888844 7:44378516-44378538 CCCACCTTGGAGGACCAGGAGGG + Intergenic
1024230723 7:47361295-47361317 CCCACCATGGAGGGCCAGGATGG - Intronic
1026052109 7:66955583-66955605 CAGAGCATCCAGGCCCAGGCTGG - Exonic
1029104996 7:98167787-98167809 CCCAGGACTGAGGACCAGGACGG + Intronic
1034458712 7:151186434-151186456 CCCAACATCGCTGACCAGGATGG - Exonic
1034469280 7:151246987-151247009 CAGAGCCTGGAGGACCAGGAGGG - Intronic
1036047684 8:5161987-5162009 CCGAGAAACGGGGAGCAGGACGG - Intergenic
1037567093 8:20127083-20127105 CCGGGCTTCCAGGAACAGGAAGG + Intergenic
1046757148 8:117983825-117983847 CAGAGTATGGAGGACCAGGTAGG - Intronic
1050388083 9:5111436-5111458 CCGAGGATGGAAGACCAGGCGGG - Intronic
1055256713 9:74380256-74380278 CCAAATATCGAGGACCAGGGAGG + Intergenic
1056835390 9:89951096-89951118 CTGAGGATGCAGGACCAGGAAGG + Intergenic
1057522606 9:95772111-95772133 CCGGGCATTCAGGGCCAGGAAGG + Intergenic
1058425050 9:104868955-104868977 CTGAGCATAGAGGACAAGGAAGG + Intronic
1058598919 9:106647636-106647658 GTGAGCATAGAGGACCAGCATGG - Intergenic
1059393667 9:114017222-114017244 CCCACCATCAAGGACCAAGAGGG - Intronic
1061053304 9:128208582-128208604 CAGAGTATCGATGACCTGGATGG + Intronic
1203781949 EBV:105686-105708 CCGCGCGTCGAGGCCCAGGAGGG + Intergenic
1190144154 X:47875147-47875169 CAGAGCAAGGAGGAGCAGGAGGG + Intronic
1190745739 X:53320978-53321000 CGGCGCATCGAGGAGCTGGAGGG - Exonic
1190779617 X:53580837-53580859 CTGAGCCTCGAGGGGCAGGAAGG + Exonic