ID: 1177809947

View in Genome Browser
Species Human (GRCh38)
Location 21:25915082-25915104
Sequence CACAGAGGGCCTTCAGCATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 215
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 197}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177809947_1177809955 8 Left 1177809947 21:25915082-25915104 CCAGATGCTGAAGGCCCTCTGTG 0: 1
1: 0
2: 1
3: 16
4: 197
Right 1177809955 21:25915113-25915135 CCACCCCGTATTTCTAGCCATGG 0: 1
1: 0
2: 0
3: 2
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177809947 Original CRISPR CACAGAGGGCCTTCAGCATC TGG (reversed) Intronic
900585157 1:3429078-3429100 CAAAGAGGGCCGGCAGCAGCGGG + Intronic
900950503 1:5855837-5855859 CACAGAGAGGCTTCAGAAGCAGG + Intergenic
901634796 1:10665482-10665504 CGCAGATGGCGTTCAGCTTCAGG + Exonic
902236651 1:15061966-15061988 CACAGTGGTCCTTCAGGATCAGG - Intronic
903363731 1:22793290-22793312 TACGGAGGGCCTTCAGCATCTGG - Intronic
903528890 1:24014327-24014349 CACATAGGGCCTTTTGTATCAGG - Intergenic
903807084 1:26013226-26013248 CACAGAATGGCTTCAGAATCAGG + Intergenic
906154327 1:43605303-43605325 CGCAGGGGGCCTGCAGCACCTGG + Exonic
908306858 1:62827578-62827600 GACACTGGGCCTTCAGCAGCAGG - Intronic
908801376 1:67884308-67884330 CACACTGGTCCTTCAGCTTCTGG + Intergenic
909417125 1:75418676-75418698 CACAGAGGCCCTGCATGATCTGG - Intronic
910022669 1:82611226-82611248 CACAGAGGGCCTTGAAAACCAGG - Intergenic
911091650 1:94022154-94022176 CTCTGAGGCCCTTCTGCATCTGG + Intronic
913211938 1:116589474-116589496 CACAAAGTCCCTTCAGGATCTGG + Intronic
914680152 1:149933412-149933434 GGCAGAGGGCCCTCAGCCTCAGG + Exonic
915680447 1:157576934-157576956 CATAGAACACCTTCAGCATCAGG + Intronic
916763505 1:167838153-167838175 CACAGAGGGCTTTCAGAAGAAGG - Intronic
917254843 1:173103477-173103499 GACAGAGGGCTTTCTGTATCGGG + Intergenic
920054687 1:203183521-203183543 TAAAGAGGGACTTCAGCCTCAGG - Intronic
923460522 1:234205972-234205994 CACAGCGTGCCCTCAGCAGCAGG - Intronic
1062870928 10:903609-903631 CACACAGGGCCTTCCTCGTCAGG + Intronic
1064002579 10:11675795-11675817 CACAGAGGGCCTTGAGTACTAGG + Intergenic
1065330961 10:24598856-24598878 CACACAGTGACTTAAGCATCAGG - Intronic
1065696753 10:28387679-28387701 CACAGTTGTCCTTTAGCATCTGG + Intergenic
1066745448 10:38601943-38601965 CACAGAGGGCCCTCCGGACCAGG + Intergenic
1069723662 10:70564488-70564510 GGCAGAGGCCCTTCAGCACCTGG + Exonic
1069780219 10:70950695-70950717 CAGAGAGGGCCTTCAGGGCCTGG - Intergenic
1071074346 10:81732980-81733002 GACAGAGGGCTTTCGGTATCTGG - Intergenic
1074523957 10:114248725-114248747 CACAGACGGCTTCCAGCAACAGG - Exonic
1076321829 10:129588744-129588766 CACAGGGTGCCTGCAGCATTTGG + Intronic
1078595687 11:12684508-12684530 TGCAGAGGGCATTCAGCTTCAGG + Intronic
1081421532 11:42878098-42878120 CACAGGGAACCTTCATCATCTGG - Intergenic
1082073972 11:47962101-47962123 CACACAGGGCATGCAGAATCAGG - Intergenic
1082586536 11:54947753-54947775 CAGAGAGGACCTTCAGCTGCAGG - Intergenic
1084179707 11:67440246-67440268 CACAGGGTGACTCCAGCATCCGG - Exonic
1085259537 11:75196381-75196403 CACAGAGGATTTTCATCATCAGG - Intronic
1086443247 11:86849005-86849027 CCCAGGGGGCCTTCATCCTCTGG - Intronic
1089729540 11:120511745-120511767 CACAGACTGCCTTCAGCTGCGGG + Exonic
1089757506 11:120697269-120697291 CACAGGGGGCATTCAGGATTTGG - Intronic
1091892379 12:4069701-4069723 CACATAGGGCCTCCAGCAATTGG + Intergenic
1091896124 12:4106520-4106542 CAGATACGGCATTCAGCATCTGG + Intergenic
1094855863 12:34402538-34402560 CACAGAGGGCCTTGGGCCACAGG + Intergenic
1097162442 12:57057493-57057515 CACAGAGGATCTGAAGCATCTGG + Exonic
1099601093 12:84738755-84738777 CAGAGATGCCCTGCAGCATCAGG + Intergenic
1099606155 12:84804076-84804098 CACAGAGGGACTTGTGCACCAGG + Intergenic
1100341669 12:93685098-93685120 CACAGAAGGCTTTAAGCATGAGG - Intronic
1102144724 12:110646134-110646156 CTCAGAGGGCCTGCAGCAGCAGG + Intronic
1103262732 12:119602504-119602526 CAGACAGGGTCTTCATCATCTGG - Intronic
1104360246 12:128126224-128126246 CAAAGAGGAACTTCAGCTTCAGG + Intergenic
1104809151 12:131610167-131610189 CAGAGAGGGCCTCCACCAACAGG - Intergenic
1104905137 12:132209150-132209172 CTTAGAGTGCCTTCACCATCTGG - Intronic
1105064175 12:133182315-133182337 TACTGAGGGCCTTCTGTATCTGG + Intronic
1105215187 13:18280100-18280122 CACAAAGTCCCTTCAGGATCTGG + Intergenic
1108317698 13:49253877-49253899 CAGTGAGGGCCTTTAGCATAAGG - Intronic
1110092215 13:71467175-71467197 CACAAGAGGCCTTCAGCATTTGG + Intronic
1111406221 13:87810775-87810797 AACAGAGGGCTTTCTGTATCTGG + Intergenic
1113570027 13:111346931-111346953 CACAGAGCGGCTGCAGCAGCAGG - Intergenic
1113937358 13:114001528-114001550 CACAGAGGACCTACAGCCGCGGG + Intronic
1119034111 14:71215499-71215521 CACGGATGGCCTCCAGCAGCAGG - Intergenic
1121850168 14:97214373-97214395 CACAGAGGCCCTTCAGGACAGGG - Intergenic
1122638621 14:103143258-103143280 CACAGAGAGCAGCCAGCATCTGG - Intergenic
1123499532 15:20867208-20867230 AACACAGGGCCATCAGCAACGGG + Intergenic
1123556784 15:21440938-21440960 AACACAGGGCCATCAGCAACGGG + Intergenic
1123593007 15:21878174-21878196 AACACAGGGCCATCAGCAACGGG + Intergenic
1124614771 15:31233781-31233803 GACTGAGGGCAGTCAGCATCAGG + Intergenic
1125089615 15:35774868-35774890 CATAGATGGCATTCAGCTTCAGG - Intergenic
1126818772 15:52480527-52480549 CAGAGAGGGCCTCAAGGATCGGG - Intronic
1129023809 15:72549498-72549520 CACAGAGGGGCTTCAGGAATGGG - Intronic
1129515453 15:76154455-76154477 CATTGATGGCCTTCACCATCTGG + Intronic
1130573582 15:85070722-85070744 CACACAAGGCCTTCATCATTTGG - Intronic
1202965127 15_KI270727v1_random:168127-168149 AACACAGGGCCATCAGCAACGGG + Intergenic
1136391757 16:29969812-29969834 CCCCCACGGCCTTCAGCATCAGG - Intronic
1136737625 16:32477706-32477728 CACAGAGGGCCCTCCGGACCAGG - Intergenic
1137712048 16:50573337-50573359 CACAGGGCAACTTCAGCATCAGG - Intronic
1203015446 16_KI270728v1_random:351871-351893 CACAGAGGGCCCTCCGGACCAGG + Intergenic
1203033781 16_KI270728v1_random:625029-625051 CACAGAGGGCCCTCCGGACCAGG + Intergenic
1148087420 17:45002695-45002717 CACAGAGTGTCTTCAGGACCTGG + Intergenic
1148201012 17:45750063-45750085 GAGAGAGGTCCTTCAGCCTCTGG - Intergenic
1148848038 17:50540667-50540689 CACAGATGGCCTGCAGCCTCAGG - Intronic
1149865474 17:60149001-60149023 CACAGAGGACCTGCAGTAGCAGG + Intergenic
1150588730 17:66541991-66542013 CACAGTGGGACTTTAGTATCAGG + Intronic
1151355562 17:73555980-73556002 CACAGATGGGCTTGAGCTTCTGG + Intronic
1152607408 17:81299668-81299690 AACAGAAGGCCTTCAGAAGCTGG - Intergenic
1156445962 18:37236958-37236980 CAAGGAGGGGCTTCAGGATCAGG - Intergenic
1161399158 19:4059897-4059919 CACAGTGGGGCTTCAGCACTCGG - Intronic
1162432269 19:10636252-10636274 CACAGTGGGCTCTGAGCATCAGG - Intronic
1163650243 19:18513294-18513316 CACACAAGGCCTGCAGCATCCGG + Intronic
1166761018 19:45224571-45224593 AACAGAGGGCCATCAGCAGGAGG - Intronic
1168306657 19:55439550-55439572 CAGAGAGGGCCTTGAGCGCCAGG - Intronic
926725853 2:15997309-15997331 CACCCAGGGCCACCAGCATCAGG - Intergenic
927147314 2:20174704-20174726 CACAGAGGGCCTTGAGACTTGGG + Intergenic
927612950 2:24560041-24560063 CAGAGAGAGCCCTCATCATCAGG - Intronic
934299134 2:91766637-91766659 CACAAAGTCCCTTCAGGATCTGG - Intergenic
934307843 2:91841134-91841156 CACAGAGGGCCCTCCGGACCAGG + Intergenic
938082771 2:128379006-128379028 CACAACCAGCCTTCAGCATCTGG - Intergenic
938296561 2:130182675-130182697 CACACATGGACTTGAGCATCTGG - Exonic
938460187 2:131491954-131491976 CACACATGGACTTGAGCATCTGG + Exonic
938739986 2:134221913-134221935 CACAGAAGGCCAACAGCAGCAGG + Intronic
942983195 2:182106655-182106677 GACAGAGGGCTTTCTGTATCCGG - Intronic
945111553 2:206365002-206365024 CATACAAGGCCTTCAGCAACAGG - Intergenic
948766433 2:240223946-240223968 CACAGAGGGGCTTAAAAATCCGG - Intergenic
1168849591 20:967379-967401 CCCAGAGGGCCTTCCACCTCGGG - Intronic
1170573047 20:17643100-17643122 TAGAGAGGGCCGTCGGCATCTGG + Exonic
1173163888 20:40672410-40672432 CAAAGAGGGCCTAAAGCAGCAGG + Intergenic
1175720969 20:61287085-61287107 CACAGAGGACCTGCAGCTTCAGG - Intronic
1175721914 20:61292877-61292899 CACAGAGGCACCTCTGCATCTGG - Intronic
1176145627 20:63564120-63564142 CACACAGGGCCTTGAGCTGCTGG + Exonic
1176816566 21:13609255-13609277 AACACAGGGCCATCAGCAACGGG - Intergenic
1177809947 21:25915082-25915104 CACAGAGGGCCTTCAGCATCTGG - Intronic
1179469343 21:41600229-41600251 CACAGAAGGCCTTGAGCACAGGG + Intergenic
1179622597 21:42627070-42627092 CACAGGGGGCCCTCAGCTCCTGG + Intergenic
1180534928 22:16388216-16388238 CACAGAGGGCCCTCTGGACCAGG + Intergenic
1181360425 22:22330016-22330038 CACAGAGGGGCTTCAGCCTGGGG + Intergenic
1181672268 22:24431218-24431240 AACGGAGGGCCTGCAGCAGCTGG - Intronic
1181978261 22:26747845-26747867 CCCAGAGGCCCTACAGAATCTGG - Intergenic
1182145827 22:27996173-27996195 CACAGAGATCCTGCAGCACCCGG - Exonic
1182831011 22:33304482-33304504 TGCAGATGGCCTCCAGCATCTGG + Exonic
1183355437 22:37356323-37356345 CCCAGAGGGTCTACAGCATGGGG + Intergenic
1183715971 22:39533873-39533895 CACAGAAGGCCCTCAGAACCCGG - Intergenic
1183733757 22:39632231-39632253 CACAGAGGGCCGGTAGCAGCTGG - Intronic
1184296919 22:43530707-43530729 CACACCGGGCCTTCGGCAGCAGG + Intronic
1184399947 22:44267919-44267941 CCCAGAGGGCCTGCAGGATAAGG - Intronic
954993659 3:54862600-54862622 CAGAGAGAGCCTTCAACTTCAGG - Intronic
956677793 3:71752449-71752471 CATAGAGGGCCTTAATGATCAGG - Intronic
962539820 3:136369201-136369223 CAGAGAGGGCCTTCAGCCTTTGG - Exonic
963429667 3:145182374-145182396 CACATAGGGCCTTAATCATGTGG + Intergenic
963918526 3:150883707-150883729 CACAGAAAGCCTCCAGCATTTGG + Exonic
964223417 3:154370559-154370581 TCCAGAGGGCCTTCATCCTCTGG - Intronic
965479420 3:169199292-169199314 CAAAGAGGGCCTCTATCATCAGG - Intronic
966639597 3:182175055-182175077 CAAGGAGGGTCCTCAGCATCAGG + Intergenic
969351729 4:6602009-6602031 CACAGATGGCCCTCGGCTTCTGG - Intronic
972300757 4:37783744-37783766 AACACAGGCCCTTCAGCTTCAGG - Intergenic
973045948 4:45534576-45534598 CCCAGAGAGCCTTCATCGTCTGG - Intergenic
974251863 4:59394802-59394824 CACAGAGGGCCAGCAGAAGCAGG - Intergenic
974993987 4:69129522-69129544 AACAGAGGGCTTTCTGTATCTGG - Intronic
975004674 4:69270373-69270395 TCCAGAGGGCCTTCATCCTCTGG - Intergenic
975013094 4:69379353-69379375 TCCAGAGGGCCTTCATCCTCTGG - Intronic
976006710 4:80439389-80439411 CACAGAGGGCTTGCAGAAGCAGG + Intronic
977849661 4:101810411-101810433 CAGATAGGACCTTCCGCATCAGG + Intronic
980485462 4:133451252-133451274 GACAGAGGGCTTTCTGTATCCGG - Intergenic
980852400 4:138398504-138398526 CAAACAGGAACTTCAGCATCAGG - Intergenic
983859332 4:172685914-172685936 GACAGATGGCATACAGCATCTGG - Intronic
983900611 4:173129326-173129348 CACAGAGGTTCTTCAGTAACAGG + Intergenic
985686605 5:1284753-1284775 CACACCGGACCTGCAGCATCCGG + Intronic
986002847 5:3643533-3643555 CAAACATGGGCTTCAGCATCTGG - Intergenic
986713936 5:10508995-10509017 AACAGAGGCCCTTGTGCATCTGG + Intronic
988513616 5:31886655-31886677 CCCAGAGGCACTTCTGCATCAGG + Intronic
989516888 5:42354059-42354081 CAGTCAGGGCCTTCAGCTTCAGG - Intergenic
991642908 5:68772350-68772372 CACAGAGGCCCTCCAGCCCCTGG + Intergenic
992849658 5:80794205-80794227 CTAAGAAGGGCTTCAGCATCTGG + Intronic
994871184 5:105351755-105351777 GACAGAGGGCTTTCTGTATCCGG + Intergenic
1000470179 5:161630956-161630978 GACAGAGGGCTTTCTGTATCCGG + Intronic
1002136464 5:177110866-177110888 CAGAGGAGGCCTTCAGGATCTGG + Intergenic
1003674684 6:8192371-8192393 CACAGAGGGGCACCAGCAACAGG + Intergenic
1004932981 6:20479587-20479609 CACAGCGATCCTTCAGCATTAGG - Intronic
1006719726 6:36142470-36142492 CACAGAGGGCCTGCAGCCCAGGG - Intronic
1009775820 6:68205451-68205473 CACAGAGGGCCAGCAGAAGCAGG + Intergenic
1011670026 6:89674471-89674493 GACAGAGCGCCTGCAGCACCTGG - Exonic
1014202322 6:118620563-118620585 CCCAGAGAGCCTTCATCATCTGG - Intronic
1014854344 6:126381135-126381157 CACTGAGGGACTACAGCAACAGG - Intergenic
1015181486 6:130366174-130366196 CACAGAGGGCCGCCGCCATCCGG - Intronic
1018312490 6:162525372-162525394 TACAGAGGCCCTTCAGGCTCAGG - Intronic
1019829606 7:3314110-3314132 CATACAGGGGATTCAGCATCTGG + Intronic
1021206364 7:17786408-17786430 TACAGGGGGCCTTCAGCAAATGG + Intergenic
1021320820 7:19208737-19208759 TACAGAAGGCCTTCTGCATCAGG + Intergenic
1022029563 7:26479915-26479937 ACCAAAGGGACTTCAGCATCTGG + Intergenic
1022545113 7:31180013-31180035 CCCAGAGGGCCTTCAGGATTAGG + Intergenic
1023875162 7:44282828-44282850 CACATTAGGCCCTCAGCATCTGG + Intronic
1025025432 7:55512792-55512814 CACAGAGGGGCCTCCCCATCAGG + Intronic
1025080173 7:55974925-55974947 CACACTGGCCCATCAGCATCTGG + Intronic
1026322483 7:69279766-69279788 CACAGTGGCCTTCCAGCATCTGG + Intergenic
1026387543 7:69865427-69865449 TACAGAGGGCTCTCAGTATCAGG + Intronic
1026454287 7:70557278-70557300 CCCCGAGGGTCTTCAGCTTCTGG - Intronic
1027245264 7:76362759-76362781 GACAGGGGTCCTCCAGCATCTGG - Intergenic
1029044166 7:97610016-97610038 CATAGGGGGCTGTCAGCATCAGG + Intergenic
1032471041 7:132179653-132179675 CACACATGGCCTCCAGCATGGGG + Intronic
1032702175 7:134391876-134391898 GTCAGAGGACCTTCTGCATCTGG + Intergenic
1034817387 7:154184146-154184168 CAGTGAGGACCCTCAGCATCAGG + Intronic
1038698104 8:29824359-29824381 AACAGAGGGGCTTCCGCAACAGG - Intergenic
1039795241 8:40907314-40907336 CACTCAAGACCTTCAGCATCAGG - Intergenic
1040522942 8:48193429-48193451 CTCAGAGGACCCCCAGCATCCGG - Intergenic
1041317414 8:56579034-56579056 CACAAAAAGCCTACAGCATCAGG + Intergenic
1042699511 8:71596886-71596908 CAGAGAAGGACTTCAGCTTCAGG + Intergenic
1044472005 8:92581454-92581476 CACAGAGTGCCTTCAGAAACTGG - Intergenic
1045929235 8:107603630-107603652 TCCAGAGGGCCTTCATCCTCTGG + Intergenic
1048293865 8:133200204-133200226 CACTGTGGGCCTTCCACATCTGG - Intronic
1048547246 8:135398578-135398600 AACAGAGTGCCTTCAGTGTCAGG - Intergenic
1049229826 8:141476158-141476180 GACAGAGGGCCATTAGCATGGGG + Intergenic
1049404366 8:142445139-142445161 CACAGAGGCCCTTCAGCCTGTGG + Intergenic
1051398950 9:16658795-16658817 GAAAGAGTGCCTTCAACATCTGG - Intronic
1052763686 9:32618643-32618665 CACAGAAATCCTTCAGGATCTGG - Intergenic
1053434053 9:38063549-38063571 CAAAGAGGGCCTTCAGCAGAAGG - Intronic
1055212007 9:73807139-73807161 CACATAGCTCCTTAAGCATCTGG + Intergenic
1055873140 9:80909312-80909334 CATAAAGGGCCTTCAGCCACAGG + Intergenic
1059407787 9:114112634-114112656 CACAGTGGGTCATCAGCATCTGG - Intergenic
1060521204 9:124295068-124295090 CAGGGTGGGCCTGCAGCATCAGG - Intronic
1060913878 9:127372803-127372825 CACAGAGGGTTTTCTGCAACTGG - Intronic
1061327427 9:129872777-129872799 CTCAGAGGACCCTCAGCCTCCGG - Intronic
1061428405 9:130515686-130515708 CACAGTGGGCCATCAGGAACGGG + Intergenic
1062234814 9:135502700-135502722 CCCAGGGAGCCATCAGCATCGGG + Intronic
1203530791 Un_GL000213v1:140212-140234 AACACAGGGCCATCAGCAACGGG + Intergenic
1188319605 X:28720242-28720264 CAGAGATGGCCATCAGCAGCTGG - Intronic
1188548033 X:31331784-31331806 CACAGAGAGCGTTCAGCAAATGG - Intronic
1188959216 X:36470407-36470429 CAGAGAGGGCCCTCAGCTGCAGG + Intergenic
1189185889 X:39054394-39054416 CACAGTGTGACTTCAGCTTCTGG - Intergenic
1189377135 X:40474873-40474895 CACAGAGGGCCTACAGGGGCAGG + Intergenic
1191788850 X:64946396-64946418 CACAGAGGGCGAGCAGAATCAGG - Intronic
1192140167 X:68640059-68640081 CACACAGGACCCTCAACATCAGG - Intergenic
1195131557 X:101858881-101858903 GACAGAGGGCTTTCTGAATCTGG - Intergenic
1196768327 X:119269895-119269917 CACAGCGGGCTTTCAGCCCCAGG + Intergenic
1200111050 X:153741068-153741090 CACAGAGGGCCCTCGGGACCAGG + Intronic
1201640186 Y:16169735-16169757 CCCAGAGGGCCTTCATCCTCTGG + Intergenic
1201662628 Y:16415590-16415612 CCCAGAGGGCCTTCATCCTCTGG - Intergenic
1201799138 Y:17935646-17935668 CACAGAGTGCTTGCAGCATGGGG + Intergenic
1201802415 Y:17970310-17970332 CACAGAGTGCTTGCAGCATGGGG - Intergenic