ID: 1177810351

View in Genome Browser
Species Human (GRCh38)
Location 21:25918727-25918749
Sequence CAGCGCGATTCCGTGGGCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2942
Summary {0: 16, 1: 450, 2: 786, 3: 859, 4: 831}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177810351_1177810357 28 Left 1177810351 21:25918727-25918749 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1177810357 21:25918778-25918800 CTGCAAGGCGGCAGCGAGGCTGG 0: 1065
1: 2097
2: 1670
3: 692
4: 624
1177810351_1177810359 30 Left 1177810351 21:25918727-25918749 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1177810359 21:25918780-25918802 GCAAGGCGGCAGCGAGGCTGGGG 0: 1061
1: 2132
2: 1737
3: 742
4: 656
1177810351_1177810354 13 Left 1177810351 21:25918727-25918749 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1177810354 21:25918763-25918785 CAGTCTGAGATCAAACTGCAAGG 0: 3663
1: 1439
2: 732
3: 491
4: 588
1177810351_1177810358 29 Left 1177810351 21:25918727-25918749 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1177810358 21:25918779-25918801 TGCAAGGCGGCAGCGAGGCTGGG 0: 1085
1: 2164
2: 1733
3: 667
4: 510
1177810351_1177810356 24 Left 1177810351 21:25918727-25918749 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1177810356 21:25918774-25918796 CAAACTGCAAGGCGGCAGCGAGG 0: 1083
1: 2030
2: 1615
3: 820
4: 595
1177810351_1177810355 16 Left 1177810351 21:25918727-25918749 CCTACGCCCACGGAATCGCGCTG 0: 16
1: 450
2: 786
3: 859
4: 831
Right 1177810355 21:25918766-25918788 TCTGAGATCAAACTGCAAGGCGG 0: 2869
1: 1007
2: 456
3: 293
4: 360

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177810351 Original CRISPR CAGCGCGATTCCGTGGGCGT AGG (reversed) Intronic
Too many off-targets to display for this crispr