ID: 1177816643

View in Genome Browser
Species Human (GRCh38)
Location 21:25985383-25985405
Sequence ATTCCTGCCCATGTTGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177816643_1177816650 10 Left 1177816643 21:25985383-25985405 CCCTCCTCAACATGGGCAGGAAT No data
Right 1177816650 21:25985416-25985438 GCTGAGGGTCTGAAAACAAAAGG No data
1177816643_1177816653 21 Left 1177816643 21:25985383-25985405 CCCTCCTCAACATGGGCAGGAAT No data
Right 1177816653 21:25985427-25985449 GAAAACAAAAGGGCAGAGGATGG No data
1177816643_1177816647 -5 Left 1177816643 21:25985383-25985405 CCCTCCTCAACATGGGCAGGAAT No data
Right 1177816647 21:25985401-25985423 GGAATCACCCGATCTGCTGAGGG No data
1177816643_1177816652 17 Left 1177816643 21:25985383-25985405 CCCTCCTCAACATGGGCAGGAAT No data
Right 1177816652 21:25985423-25985445 GTCTGAAAACAAAAGGGCAGAGG No data
1177816643_1177816646 -6 Left 1177816643 21:25985383-25985405 CCCTCCTCAACATGGGCAGGAAT No data
Right 1177816646 21:25985400-25985422 AGGAATCACCCGATCTGCTGAGG No data
1177816643_1177816651 11 Left 1177816643 21:25985383-25985405 CCCTCCTCAACATGGGCAGGAAT No data
Right 1177816651 21:25985417-25985439 CTGAGGGTCTGAAAACAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177816643 Original CRISPR ATTCCTGCCCATGTTGAGGA GGG (reversed) Intronic