ID: 1177816649

View in Genome Browser
Species Human (GRCh38)
Location 21:25985409-25985431
Sequence TTTTCAGACCCTCAGCAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177816649_1177816654 21 Left 1177816649 21:25985409-25985431 CCGATCTGCTGAGGGTCTGAAAA No data
Right 1177816654 21:25985453-25985475 AGTTCACCCTTTTTATTTCCTGG No data
1177816649_1177816652 -9 Left 1177816649 21:25985409-25985431 CCGATCTGCTGAGGGTCTGAAAA No data
Right 1177816652 21:25985423-25985445 GTCTGAAAACAAAAGGGCAGAGG No data
1177816649_1177816653 -5 Left 1177816649 21:25985409-25985431 CCGATCTGCTGAGGGTCTGAAAA No data
Right 1177816653 21:25985427-25985449 GAAAACAAAAGGGCAGAGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177816649 Original CRISPR TTTTCAGACCCTCAGCAGAT CGG (reversed) Intronic