ID: 1177816650

View in Genome Browser
Species Human (GRCh38)
Location 21:25985416-25985438
Sequence GCTGAGGGTCTGAAAACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177816643_1177816650 10 Left 1177816643 21:25985383-25985405 CCCTCCTCAACATGGGCAGGAAT No data
Right 1177816650 21:25985416-25985438 GCTGAGGGTCTGAAAACAAAAGG No data
1177816645_1177816650 6 Left 1177816645 21:25985387-25985409 CCTCAACATGGGCAGGAATCACC No data
Right 1177816650 21:25985416-25985438 GCTGAGGGTCTGAAAACAAAAGG No data
1177816644_1177816650 9 Left 1177816644 21:25985384-25985406 CCTCCTCAACATGGGCAGGAATC No data
Right 1177816650 21:25985416-25985438 GCTGAGGGTCTGAAAACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177816650 Original CRISPR GCTGAGGGTCTGAAAACAAA AGG Intronic