ID: 1177816652

View in Genome Browser
Species Human (GRCh38)
Location 21:25985423-25985445
Sequence GTCTGAAAACAAAAGGGCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177816644_1177816652 16 Left 1177816644 21:25985384-25985406 CCTCCTCAACATGGGCAGGAATC No data
Right 1177816652 21:25985423-25985445 GTCTGAAAACAAAAGGGCAGAGG No data
1177816645_1177816652 13 Left 1177816645 21:25985387-25985409 CCTCAACATGGGCAGGAATCACC No data
Right 1177816652 21:25985423-25985445 GTCTGAAAACAAAAGGGCAGAGG No data
1177816643_1177816652 17 Left 1177816643 21:25985383-25985405 CCCTCCTCAACATGGGCAGGAAT No data
Right 1177816652 21:25985423-25985445 GTCTGAAAACAAAAGGGCAGAGG No data
1177816649_1177816652 -9 Left 1177816649 21:25985409-25985431 CCGATCTGCTGAGGGTCTGAAAA No data
Right 1177816652 21:25985423-25985445 GTCTGAAAACAAAAGGGCAGAGG No data
1177816648_1177816652 -8 Left 1177816648 21:25985408-25985430 CCCGATCTGCTGAGGGTCTGAAA No data
Right 1177816652 21:25985423-25985445 GTCTGAAAACAAAAGGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177816652 Original CRISPR GTCTGAAAACAAAAGGGCAG AGG Intronic