ID: 1177820619

View in Genome Browser
Species Human (GRCh38)
Location 21:26027394-26027416
Sequence AAACTGGAAGGTACAATGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 2, 3: 15, 4: 174}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177820613_1177820619 15 Left 1177820613 21:26027356-26027378 CCTTCTCTCTGTCTCAACTCTCC 0: 1
1: 0
2: 4
3: 124
4: 959
Right 1177820619 21:26027394-26027416 AAACTGGAAGGTACAATGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 174
1177820614_1177820619 -6 Left 1177820614 21:26027377-26027399 CCAAACTGCCAGAGTCTAAACTG 0: 1
1: 0
2: 1
3: 15
4: 138
Right 1177820619 21:26027394-26027416 AAACTGGAAGGTACAATGGCTGG 0: 1
1: 0
2: 2
3: 15
4: 174

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177820619 Original CRISPR AAACTGGAAGGTACAATGGC TGG Intronic
901433418 1:9232259-9232281 AAACTGGAAGGTACAGAGGCAGG + Intergenic
901763093 1:11483182-11483204 CAGCTGGAAGGTACACGGGCGGG + Intronic
904918171 1:33985325-33985347 AAACTGTGAGGAACAATGCCAGG + Intronic
908418093 1:63932870-63932892 GAACTGGGTGGTAGAATGGCAGG + Intronic
910481831 1:87667157-87667179 AAAGTGGTAGTTCCAATGGCCGG - Intergenic
912207545 1:107525004-107525026 AAAGAGGAAGGAAGAATGGCAGG - Intergenic
915080576 1:153349118-153349140 AAACTGGGAGGTACAATCTCAGG + Intergenic
915496808 1:156287658-156287680 AGGCTGGAGAGTACAATGGCAGG + Intronic
916689554 1:167177255-167177277 AAACAGGAAGGGACAAGGGAGGG - Intergenic
918228043 1:182504398-182504420 AGACTAGTAAGTACAATGGCTGG + Intronic
919551405 1:198993632-198993654 AAACTGGAAGGAAAACTGGAAGG - Intergenic
920028863 1:203023429-203023451 AAACTGGAAGCAACAATTTCAGG - Exonic
921141097 1:212307108-212307130 AAAACGGAAAGTAAAATGGCAGG - Intronic
922038604 1:221874001-221874023 AAACAGGAAGGCAGAATGGAAGG + Intergenic
922155497 1:223037400-223037422 AGACAGGAAGGTACAGAGGCTGG + Intergenic
924030874 1:239884370-239884392 AAACTGGAAGGGACAAGGAAAGG + Intronic
924612754 1:245587517-245587539 AGACGGGACGGAACAATGGCCGG - Intronic
1062960645 10:1571003-1571025 AAACTGGAAGACCCAATGACAGG - Intronic
1065312881 10:24433217-24433239 AAACTCTAAGGCAAAATGGCAGG - Intronic
1069706083 10:70459749-70459771 AAAGTGGAAGGAACAGAGGCTGG + Intergenic
1070218505 10:74413420-74413442 AAAGTGCAAGGTAAAATAGCAGG - Intronic
1071422175 10:85511619-85511641 AAAATGGAAGGTAAACTGTCTGG + Intergenic
1072076149 10:91976146-91976168 AAACTGGTAATTACAATTGCCGG + Intronic
1072866289 10:99065857-99065879 AAACTGGAAGTTAGAAGGGTTGG - Intronic
1078223371 11:9370312-9370334 GAACTGAAAATTACAATGGCCGG + Intergenic
1080783408 11:35452195-35452217 GAACTGAAAAGTATAATGGCAGG + Intronic
1082237243 11:49833735-49833757 AAATTGGAAGTTACAAGGACAGG + Intergenic
1083154100 11:60811831-60811853 AAACTGGATGGTAAAAAAGCTGG - Intergenic
1083638562 11:64133278-64133300 AAACTGGAAAGAAGACTGGCAGG + Intronic
1087138438 11:94742786-94742808 AAACTGGCAGGTTCAGTGTCTGG + Intronic
1087426373 11:97992152-97992174 AAACTAGAAGGTAAAATGTGGGG + Intergenic
1089610987 11:119668773-119668795 AAATTAGAAGTTACCATGGCTGG + Intronic
1092491282 12:8948026-8948048 AGACTGGAAAGGAAAATGGCAGG - Intronic
1095265477 12:40151807-40151829 AAACTGGAAGGGATAATAGCCGG + Intergenic
1096859940 12:54518468-54518490 AAACTGGATGTTAGAATGGCAGG + Intronic
1097227162 12:57484393-57484415 TAACTAGGAGGTACGATGGCAGG + Intronic
1098442003 12:70528858-70528880 AAACTGGAAGGTGCAAAAGCAGG + Intronic
1099176428 12:79428160-79428182 AGACTGGATGGTACAGTGCCTGG + Intronic
1100625634 12:96328517-96328539 AAATAGGAAGCTACAATGGTGGG + Intronic
1103330910 12:120153525-120153547 AAACTGGAAGAGCCACTGGCTGG - Intronic
1103391218 12:120574942-120574964 AAACTGGAGGGTACTAGGCCGGG + Intronic
1105741693 13:23331406-23331428 AAACTGGAACTTCCAATGCCTGG - Exonic
1105960910 13:25338076-25338098 AAACTGGCTGGTAGTATGGCAGG + Intronic
1105985540 13:25562659-25562681 AAGCTGAAAGGTACAATCACTGG - Intronic
1106280375 13:28262625-28262647 AAAATGGAAGGCACAAAGACCGG + Intronic
1107215508 13:37913633-37913655 GAACAGAAAGGTAAAATGGCAGG - Intergenic
1109830171 13:67775747-67775769 AAAGAGGAAGGTACTATGCCCGG + Intergenic
1111124531 13:83897279-83897301 AAAATGGGAGCTACATTGGCTGG + Intergenic
1111172844 13:84551553-84551575 GAACTGGAAGGTACTCTTGCTGG + Intergenic
1111896579 13:94149798-94149820 AAACTACAAGGTACACTGGGAGG - Intronic
1112228274 13:97562519-97562541 AGAGTGGAAAGAACAATGGCAGG - Intergenic
1113218511 13:108070995-108071017 AACGTGGAAAGTGCAATGGCAGG + Intergenic
1115075742 14:29388082-29388104 CAACTGGATGGTTAAATGGCAGG - Intergenic
1115677861 14:35700394-35700416 AAACTAAAAGGTACAAAGGAAGG + Intronic
1118695355 14:68379622-68379644 ACATTGGAAGGTAGAATGGAGGG + Intronic
1120676086 14:87423061-87423083 AACCTGGCAGGTACCATGGGTGG + Intergenic
1122667665 14:103344375-103344397 AGACTGGGAGGTGCAATGTCAGG + Exonic
1125669862 15:41463334-41463356 ATACTGGAAAGTAGAATTGCTGG + Intronic
1126508238 15:49433710-49433732 ACACTGGAAGGTTGATTGGCAGG + Intronic
1127894658 15:63286089-63286111 AGAGTGGAAGGTACAAGGGAGGG + Intronic
1128576276 15:68777426-68777448 AAAATGGAAGGAAAAATGGAAGG - Intergenic
1131443283 15:92474906-92474928 CAAGTGGAAGGTATGATGGCTGG - Intronic
1131629059 15:94156909-94156931 AAACTGGCACGTACAATGTCTGG - Intergenic
1132343594 15:101093206-101093228 AAACTGCAAGATAGAATAGCGGG + Intergenic
1137036591 16:35574338-35574360 AAACTGAAAGGGACAAAGGGAGG - Intergenic
1137320471 16:47375894-47375916 AAACTGGAAGGTACTAGTGGTGG + Exonic
1138939893 16:61777592-61777614 AGACTGGAAGGAACAAGGGCAGG + Intronic
1141638313 16:85327304-85327326 AAACTGGAAGGTTCTAAGGCCGG + Intergenic
1143638921 17:8184161-8184183 AGACTGGAAGGAAGTATGGCAGG + Intergenic
1144291540 17:13831540-13831562 GACCAGGAAGGTACAATGGAGGG + Intergenic
1144526023 17:15990565-15990587 AAACTAGAAAATAAAATGGCAGG + Intronic
1146075331 17:29723570-29723592 GAACGGGAAGGTAACATGGCAGG + Intronic
1146340762 17:32018069-32018091 AAACTCAAAGGTAACATGGCTGG + Intronic
1147372991 17:40006525-40006547 AAACTGGAAGGTAGCCGGGCAGG - Intergenic
1148013307 17:44503232-44503254 AAACTGGAAGGAAAGAGGGCTGG + Intronic
1148959458 17:51381036-51381058 AATCTGGAAAGTCTAATGGCAGG - Intergenic
1151064477 17:71134612-71134634 AATCTGGAAGGTACCAGGGTAGG - Intergenic
1203171286 17_GL000205v2_random:149526-149548 GAACTGGAAGGTAAACTGTCAGG - Intergenic
1155053496 18:22167104-22167126 AATCTGGAGGGTAAAATGCCGGG + Intergenic
1156502823 18:37570413-37570435 AAACTGGAAGGGAGAAAAGCAGG + Intergenic
1158565202 18:58549271-58549293 AAATTGCAAGGTACAACAGCAGG + Intronic
1158785580 18:60707856-60707878 AATCTGAGAGGTACAATGGTTGG - Intergenic
1160349813 18:78167589-78167611 AAAGTGAAAGGCACAGTGGCGGG - Intergenic
1162937950 19:13991076-13991098 GAACTAGAAGGAGCAATGGCAGG + Intronic
1163323395 19:16587566-16587588 ACACTGGGAGGAACAATGACGGG + Intronic
1165324959 19:35109105-35109127 AAGCTGGAGGGGACAAAGGCTGG + Intergenic
1165419488 19:35715919-35715941 AACCTGGAAGGAACAGTGGGAGG - Exonic
1168403080 19:56097246-56097268 ATACTGGTAGGAATAATGGCCGG - Intronic
927013189 2:18927839-18927861 GAAAAGGAAGGTAGAATGGCTGG - Intergenic
929246680 2:39709984-39710006 GAAGTTGAAGGTTCAATGGCAGG + Intronic
934150922 2:89146883-89146905 AGACTGGAAGGTGCAAGGCCTGG - Intergenic
934216351 2:90035142-90035164 AGACTGGAAGGTGCAAGGCCTGG + Intergenic
935499464 2:103820560-103820582 AAACTGGAAGGAATAAGGACGGG - Intergenic
939374859 2:141351350-141351372 AATGTGGAAGGTACAATAGAAGG - Intronic
939400268 2:141683745-141683767 AAATTGGGAGATACATTGGCAGG + Intronic
942302217 2:174572833-174572855 AAACTGAGAGGTACAAGGGCTGG - Intronic
943825715 2:192388742-192388764 AAAAAGGAAGGTACAAAGGAGGG + Intergenic
946671780 2:222112565-222112587 AAGCTGGAAGTTACGATGGTGGG - Intergenic
947281926 2:228464541-228464563 AATCTGCAAGGTAGAATGGCAGG + Intergenic
947395285 2:229680565-229680587 ACACTGGAATGTCCAATGGCAGG + Intronic
948315324 2:237024178-237024200 AAACTGGAAAGCCCAGTGGCAGG - Intergenic
1170065487 20:12305593-12305615 AAACAGGAGGGCACAATGGCTGG + Intergenic
1170669166 20:18414613-18414635 ATTCTGGAAGGTAGAATGGCTGG - Intronic
1175270284 20:57729079-57729101 TAACTGGCAGGTACAAAGACAGG - Intergenic
1176327267 21:5511354-5511376 GAACTGGAAGGTAAACTGTCAGG - Intergenic
1176400490 21:6309597-6309619 GAACTGGAAGGTAAACTGTCAGG + Intergenic
1176436667 21:6679507-6679529 GAACTGGAAGGTAAACTGTCAGG - Intergenic
1176460929 21:7006577-7006599 GAACTGGAAGGTAAACTGTCAGG - Intergenic
1176484490 21:7388355-7388377 GAACTGGAAGGTAAACTGTCAGG - Intergenic
1177820619 21:26027394-26027416 AAACTGGAAGGTACAATGGCTGG + Intronic
1178638472 21:34326475-34326497 AAAGTGGAAGGTGCAAAGGGAGG - Intergenic
1180023019 21:45141451-45141473 AAACTGGAACATACATTGACAGG - Intronic
1182169991 22:28218813-28218835 AAACTTGAAGTTAAAAGGGCTGG - Intronic
952759094 3:36898083-36898105 AACCTGGAAGGGCCGATGGCGGG - Intronic
953643962 3:44736512-44736534 CAACAGGAAGGTTCAATGGTGGG - Exonic
954107042 3:48415039-48415061 AAACTGGAAGGAAGACAGGCAGG + Exonic
954401234 3:50320963-50320985 AAACTGGAAGGAACGCTGCCGGG + Exonic
956609250 3:71105512-71105534 AAACCACAAGGTAAAATGGCAGG + Intronic
960338849 3:116450634-116450656 AAAGAGGAAGGTCCAAGGGCTGG - Intronic
961517451 3:127446817-127446839 CAGATGGGAGGTACAATGGCAGG - Intergenic
961533776 3:127556927-127556949 AATCTGTAAGCTTCAATGGCTGG + Intergenic
961593666 3:127999670-127999692 AAACAGAATGGTTCAATGGCTGG + Intergenic
962229507 3:133649524-133649546 AAACTGGAATTTCCACTGGCTGG + Exonic
963828433 3:149981767-149981789 AAACTGGAAGCAACAATTTCAGG + Intronic
966220692 3:177548339-177548361 AAACAGGAGGGTGCAGTGGCTGG - Intergenic
966596044 3:181725727-181725749 AAACTGGAAGGTGGCATGGAGGG - Intergenic
968128824 3:196180097-196180119 GAACTGGAAGGTTCCATGACGGG + Intergenic
968941594 4:3641825-3641847 AAAATGGAAGGGAAAATGGAAGG - Intergenic
976277834 4:83295670-83295692 AATCTTTAAGCTACAATGGCAGG + Intronic
977760545 4:100730972-100730994 AAACTTGAAGCTATAATGGCTGG + Intronic
978932534 4:114332716-114332738 AGAGTGGAAGGTAAAATGGGAGG - Intergenic
981288851 4:143050742-143050764 AAACTGGATTGTACAATGCTTGG - Intergenic
981887227 4:149690873-149690895 AACCTGGAAGGTACAGAGCCAGG + Intergenic
981916277 4:150036971-150036993 AGACTTGAAGGTACAATGCAAGG - Intergenic
985813816 5:2111654-2111676 GAACAGGAAGGTTCCATGGCAGG - Intergenic
987118923 5:14748332-14748354 AAACTGGCAGGCACTCTGGCTGG + Intronic
987456258 5:18150922-18150944 CAACTGGAAGCCACAGTGGCTGG - Intergenic
992991869 5:82292081-82292103 GAGCAGGAAGGTACAATGCCAGG + Intronic
993455972 5:88127421-88127443 ATATTTCAAGGTACAATGGCAGG - Intergenic
993605829 5:89989820-89989842 CAGCTGGAAGCTACAAAGGCAGG + Intergenic
995483189 5:112613281-112613303 AAAGACGATGGTACAATGGCTGG - Intergenic
995900132 5:117056129-117056151 GAACTGGAGGGGAGAATGGCTGG - Intergenic
996289370 5:121834093-121834115 AAACATGAAAGAACAATGGCTGG + Intergenic
996936158 5:128951072-128951094 AAACTCTAGGGTAGAATGGCTGG - Intronic
998151575 5:139760418-139760440 GAACAGGAAGGGGCAATGGCAGG - Intergenic
999804718 5:155071003-155071025 GAACTGGAAGGCTCAAGGGCTGG + Intergenic
1000248319 5:159468947-159468969 AAAGTGGAATGTTCAAAGGCAGG + Intergenic
1008063609 6:47024826-47024848 AAACATAAAGCTACAATGGCTGG + Intronic
1009310621 6:62147669-62147691 AATCTGGAAAGTCCAGTGGCTGG + Intronic
1009835185 6:68991391-68991413 GAAATAGAAGGCACAATGGCAGG + Intronic
1010288750 6:74110943-74110965 AAAATGGAAAGTACACTGGTTGG + Intergenic
1011080655 6:83487085-83487107 GAACTGGAAGGAACAAGGTCAGG + Intergenic
1011710337 6:90046649-90046671 AATATGGAAGGTACTAAGGCAGG + Intronic
1011982722 6:93403331-93403353 AAACTGCTAGGTATCATGGCGGG + Intronic
1015318628 6:131846295-131846317 AAACGGGAATGGACAATGGGTGG - Intronic
1015577560 6:134689438-134689460 GAACTGGAAGGGACAATGCTGGG - Intergenic
1016657095 6:146531796-146531818 AATCTGCAAGGTAGATTGGCAGG - Intergenic
1016924741 6:149332735-149332757 AAACAGGAATGTAAAATAGCTGG + Intronic
1018462332 6:164010294-164010316 AACCTGGAACGTACCTTGGCGGG - Intergenic
1018478002 6:164161998-164162020 ACACTGGAGGGCACACTGGCCGG - Intergenic
1024890720 7:54198780-54198802 TAACTGGAAGTTACAATGAAGGG + Intergenic
1025281812 7:57631489-57631511 AAACTTGAAGTTCCAAGGGCTGG + Intergenic
1028636129 7:92991369-92991391 AAACTGGATTGTGCAATTGCAGG - Intergenic
1029107770 7:98192461-98192483 AAACTGGAACTTAAAGTGGCAGG - Exonic
1029346475 7:99982480-99982502 AAACTGCAAGATACAATGCCAGG + Intergenic
1029558743 7:101288388-101288410 AAACTGCAAGGTACAATGCCAGG - Intergenic
1030421022 7:109306381-109306403 TAACTGTTAGGTAAAATGGCTGG + Intergenic
1031781384 7:125970907-125970929 AAAATAGAAGTCACAATGGCTGG - Intergenic
1031984029 7:128150780-128150802 AACCAGGATGGTACAATGCCTGG + Intergenic
1032669170 7:134067749-134067771 AAATTGGAAGGTATACTGACAGG - Intergenic
1033918350 7:146356344-146356366 AAATGGGGAAGTACAATGGCAGG - Intronic
1035969192 8:4228342-4228364 AAACTGGAAAGGAAAATGGGAGG - Intronic
1046113266 8:109752413-109752435 AAACCATAAGGTACAATGACAGG - Intergenic
1050306141 9:4307909-4307931 AAACTGTAAGATAGAATTGCGGG + Intronic
1050657315 9:7843161-7843183 GAAATGGAAGCTACAATGCCTGG + Intronic
1052503778 9:29326368-29326390 GAAAAAGAAGGTACAATGGCTGG - Intergenic
1056129487 9:83569642-83569664 AAACTGGAAGATATTATGCCTGG - Intergenic
1061424592 9:130491138-130491160 AAGCTGCAAGGAACAATGGCAGG - Intronic
1061430669 9:130528350-130528372 AAAAAGGAAGGTAGAATGGAAGG + Intergenic
1061479590 9:130890539-130890561 AAGCTGGAAAGTACCATGTCAGG + Intergenic
1061519437 9:131109260-131109282 AGAATGGAAGGTCCACTGGCCGG + Intronic
1203434845 Un_GL000195v1:129152-129174 GAACTGGAAGGTAAACTGTCAGG + Intergenic
1186023720 X:5285353-5285375 AAACTGGAAAGTTCTGTGGCCGG - Intergenic
1186252038 X:7678588-7678610 AAGCTGCAAGGCACAATTGCAGG - Intergenic
1186643455 X:11482014-11482036 AACCTGGAAGCTACAGTTGCAGG + Intronic
1189904758 X:45746523-45746545 AAACTGGTAGGTACGTGGGCAGG + Intergenic
1194461645 X:94176984-94177006 AAAACGGAAGATACAATGGGAGG - Intergenic
1195498882 X:105570705-105570727 AAAGTGGGAGGTAGAATGGTTGG - Intronic
1196350027 X:114717987-114718009 AAACTGTGGGGTACAAAGGCTGG - Intronic
1199791890 X:151162506-151162528 AAACAGGAAGTCAGAATGGCAGG - Intergenic
1200164600 X:154027353-154027375 AAACTGGAAGGGAAAGAGGCTGG + Intronic
1200352666 X:155515148-155515170 AAACTGGAAGGAATGATGCCAGG - Intronic