ID: 1177824751

View in Genome Browser
Species Human (GRCh38)
Location 21:26069664-26069686
Sequence TACCCAGGAGAATCTAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 189
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 172}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177824751_1177824755 7 Left 1177824751 21:26069664-26069686 CCTCTTTTAGATTCTCCTGGGTA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1177824755 21:26069694-26069716 GACTTAAAATGCCTCACTTTGGG 0: 1
1: 0
2: 2
3: 14
4: 188
1177824751_1177824757 30 Left 1177824751 21:26069664-26069686 CCTCTTTTAGATTCTCCTGGGTA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1177824757 21:26069717-26069739 AGACAATGTAATTTAACCATTGG 0: 1
1: 0
2: 2
3: 32
4: 252
1177824751_1177824754 6 Left 1177824751 21:26069664-26069686 CCTCTTTTAGATTCTCCTGGGTA 0: 1
1: 0
2: 0
3: 16
4: 172
Right 1177824754 21:26069693-26069715 AGACTTAAAATGCCTCACTTTGG 0: 1
1: 0
2: 0
3: 11
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177824751 Original CRISPR TACCCAGGAGAATCTAAAAG AGG (reversed) Intronic
902738301 1:18415858-18415880 TACCCCAGATAGTCTAAAAGGGG + Intergenic
907481217 1:54746738-54746760 TATCCAGGACACTCTAAAACAGG - Intergenic
911863806 1:102990729-102990751 TTACCAGTAAAATCTAAAAGTGG + Intronic
912378428 1:109232024-109232046 TACCCAGGGAAAGGTAAAAGAGG - Intronic
916968027 1:169974206-169974228 AACCTTGGTGAATCTAAAAGAGG + Intronic
917874458 1:179273219-179273241 TACCCAGGGGAATCAAGAATGGG + Intergenic
918168239 1:181970896-181970918 AACCCAGGAAAATCTAGAAATGG + Intergenic
919701376 1:200634727-200634749 TAACCAGGAGAAGGTAGAAGAGG - Intronic
919804152 1:201370984-201371006 TTCACAGGAGAAACTGAAAGAGG - Intronic
920616749 1:207500520-207500542 GAACCAGGAGAATGTGAAAGTGG + Intronic
922002486 1:221494221-221494243 TGTCCAGGAGACTATAAAAGAGG + Intergenic
923057599 1:230438904-230438926 TACCCAGGACAATGTGAGAGAGG + Intergenic
923123797 1:231018058-231018080 TCCCCAGGTGATTCTTAAAGTGG + Intergenic
1062902347 10:1155987-1156009 TACAGAGAAGAATCGAAAAGAGG - Intergenic
1064047963 10:12035429-12035451 GACCCAGGACAATCTGTAAGAGG + Exonic
1065096818 10:22289016-22289038 TACCCAAAAGAATGGAAAAGAGG - Intergenic
1070184295 10:74045788-74045810 TACACAGGGGCATCTAAAAGTGG + Intronic
1071785768 10:88898002-88898024 GGGCCAGGAGAATCTAAAACAGG - Intronic
1072085363 10:92073840-92073862 CACACAGGAGAATCTAAGAGAGG - Intronic
1073433003 10:103499023-103499045 TACCCAGAAGAACCGAAAACAGG - Intronic
1076181635 10:128413790-128413812 TACCCAGAAGAATATGAAAATGG + Intergenic
1078196756 11:9143121-9143143 GACCCAGGCAAATCTAGAAGAGG + Intronic
1080122950 11:28698286-28698308 TTCCCAGCAAAATCTCAAAGTGG + Intergenic
1080132582 11:28814312-28814334 TACACAGGAGAATCCATAAAGGG - Intergenic
1082748130 11:56989711-56989733 TTCCCAGGAAAATATGAAAGTGG + Exonic
1082751123 11:57018889-57018911 TTCCCAGGAGAATATGAAAGTGG + Intergenic
1085779695 11:79396968-79396990 TGCTCAGGAGAAACTCAAAGAGG - Intronic
1086558394 11:88139234-88139256 TACCCAGGAGTTCCTAAGAGTGG + Intronic
1087336004 11:96845698-96845720 TACCCAGGGCCATCGAAAAGTGG - Intergenic
1089297439 11:117478490-117478512 TATCCAGGAGAAAAGAAAAGAGG - Intronic
1093034223 12:14317919-14317941 CTCCCAGAAGAAGCTAAAAGAGG - Intergenic
1093945252 12:25100396-25100418 TACCCAGAAGAATTGAAAACAGG + Intronic
1095222020 12:39626710-39626732 AACTCAGAAGAACCTAAAAGAGG - Intronic
1095607734 12:44090327-44090349 AACCCTGGAGAATCCAAAAGTGG - Intronic
1096264059 12:50110090-50110112 TTGCTAGGAGAAGCTAAAAGGGG - Exonic
1097691608 12:62739380-62739402 AACACAGGAGAATTTGAAAGGGG + Intronic
1101156330 12:101931071-101931093 TACCCAGAAGAATTTAAAGCAGG - Intronic
1101825902 12:108219757-108219779 TACCCAGGACAACCCCAAAGGGG + Intronic
1103788006 12:123447938-123447960 TACCCAGAAGAATTGAAAACAGG + Intergenic
1104830888 12:131750520-131750542 GACCCAGGAGATTCTCACAGAGG - Intronic
1107640880 13:42441941-42441963 AACCCAGTAGAATCTGAGAGAGG + Intergenic
1112489695 13:99850679-99850701 TACCCAAAAGAATTGAAAAGAGG + Intronic
1112704568 13:102051785-102051807 TAGCCAGTAGAGTCTGAAAGTGG + Intronic
1112876515 13:104047014-104047036 AACCCAGGAGAACATAAAACTGG + Intergenic
1113635601 13:111916983-111917005 GACCCAGGACAGTCTCAAAGTGG - Intergenic
1114160413 14:20159593-20159615 TACCCAAGAGAATTGAAAACAGG + Intergenic
1120150486 14:81027447-81027469 AACCCAAGAGTATCTAAAAAAGG + Intronic
1120911436 14:89670391-89670413 TACCCAAAATAATTTAAAAGAGG + Intergenic
1121740054 14:96245452-96245474 TAGTGAGTAGAATCTAAAAGAGG - Intronic
1125693340 15:41614743-41614765 TACCAAAGAAAATCTACAAGTGG - Intergenic
1125856957 15:42959553-42959575 TACTCTGGAAAATTTAAAAGAGG - Intronic
1127358253 15:58222466-58222488 TTCCCAGGAGAAAGGAAAAGAGG - Intronic
1127532235 15:59854878-59854900 TTCTCAGGAGAGTCTAAGAGTGG + Intergenic
1127854992 15:62946871-62946893 CAGCCAGGAGAATGGAAAAGGGG + Intergenic
1129121258 15:73398169-73398191 TCCCCAGGAGATTCTAACACTGG - Intergenic
1129947729 15:79555531-79555553 TACCCAGAAGAATTAAAAACAGG - Intergenic
1130074795 15:80679369-80679391 TACCCTATAGAGTCTAAAAGGGG - Intergenic
1131098671 15:89671603-89671625 TCCCCATGAGAATCTAGCAGTGG + Intronic
1133345727 16:5069186-5069208 CACCCAGGAGAATGAAAAACAGG - Intronic
1135782763 16:25319626-25319648 TACCCAGTAGAATATAACAGAGG - Intergenic
1140798301 16:78461231-78461253 TGCCCAGGAGAAGCTAGAATTGG - Intronic
1141066125 16:80915507-80915529 TCCCCAGGAACCTCTAAAAGGGG - Intergenic
1141685747 16:85568926-85568948 TTCCCAGGAGGCTCTAAGAGGGG - Intergenic
1143699146 17:8645035-8645057 TTCCCATGAGATTCTCAAAGTGG - Intergenic
1144591194 17:16525297-16525319 TACCCAAGAGAATTGAAAACAGG + Intergenic
1146019338 17:29263502-29263524 TTCTCAGCAAAATCTAAAAGGGG - Exonic
1148370432 17:47095707-47095729 TACCCAAGAGAACTGAAAAGAGG + Intergenic
1151064588 17:71135319-71135341 TAGCCAGCAGAACCTGAAAGTGG - Intergenic
1151498460 17:74473759-74473781 GACCCTGGAGAATCTCACAGAGG + Exonic
1151508604 17:74544702-74544724 GACCCTGGAGAATCTCACAGAGG - Exonic
1152866415 17:82726395-82726417 TACCCACAAGCATCTCAAAGTGG - Intronic
1153250867 18:3120123-3120145 CACCCAGGAGATTACAAAAGGGG - Intronic
1157524068 18:48365555-48365577 TAACCATGAGAATAGAAAAGTGG + Intronic
1157754421 18:50205305-50205327 TACCAAAAAGAATCTAAATGTGG + Intergenic
1158866345 18:61641121-61641143 TACCCAAAAGAATTGAAAAGAGG + Intergenic
1159377533 18:67612954-67612976 CACACTGGAGAATCTAAAAAGGG + Intergenic
1161667229 19:5584662-5584684 TACACAGGAGAATGGAAAACAGG + Intergenic
1163711310 19:18848818-18848840 TACCCAGAAGATTCTGAAAATGG - Intronic
1166466510 19:43036613-43036635 CACCCAGGAGAATAAAACAGAGG - Intronic
1166472648 19:43092688-43092710 CACCCAGGAGAATAAAACAGAGG - Intronic
1166493415 19:43279674-43279696 CACCCAGGAGAATGAAACAGAGG - Intergenic
1167813741 19:51859332-51859354 TACCCATGAGAATTGAAAACAGG - Intronic
926069766 2:9877683-9877705 TACCCAGGACGATCTATAAGGGG + Intronic
927289940 2:21395423-21395445 TGCCCCGGAGAATCCTAAAGGGG + Intergenic
928087176 2:28353077-28353099 TTCCCAGGAGAAACTCAATGGGG - Intergenic
929453399 2:42050761-42050783 TACCCAGGAAAAGTGAAAAGTGG + Intronic
929884209 2:45863872-45863894 TGCACTGGAGAGTCTAAAAGGGG + Intronic
929995263 2:46821974-46821996 TGCACAGGAGAATCTCAAGGAGG - Intronic
933948501 2:87308655-87308677 TCCCCAGAAGAATCTAACTGTGG - Intergenic
936331698 2:111552940-111552962 TCCCCAGAAGAATCTAACTGTGG + Intergenic
938761861 2:134433376-134433398 TACGCAGGAGAAACGAAAACAGG - Intronic
939251578 2:139687564-139687586 TACCCAAGAGAATTTAAAACTGG - Intergenic
939666692 2:144961708-144961730 TAGTCAGTAGAATATAAAAGAGG + Intergenic
940197626 2:151113559-151113581 TACCCTGTATAATCTGAAAGGGG + Intergenic
942719217 2:178931325-178931347 TACCCAAAAGAATTGAAAAGAGG + Intronic
942948643 2:181697656-181697678 TACCCAGGAGAATTGAAAGAAGG - Intergenic
944289539 2:197989877-197989899 TACCTGGGAGAATCTCCAAGTGG - Intronic
944645125 2:201772167-201772189 TATCCAGTGGAGTCTAAAAGTGG - Intronic
948114042 2:235480459-235480481 TACCCAGAAGAATCAAAAGCAGG + Intergenic
1170309909 20:14981315-14981337 TACCCAGGTGAATGGAAAAGAGG - Intronic
1173765088 20:45599876-45599898 TACCCATGGTAATCTAGAAGCGG - Intergenic
1174703521 20:52633487-52633509 TACCAAGGAAAATCAGAAAGAGG - Intergenic
1177404663 21:20649653-20649675 TACCCAAAAGAATTTAAAATAGG + Intergenic
1177824751 21:26069664-26069686 TACCCAGGAGAATCTAAAAGAGG - Intronic
1178482759 21:32993898-32993920 TACCAAGAAGAATTAAAAAGGGG + Intergenic
1178576782 21:33799830-33799852 TGCACAGGAAAATGTAAAAGTGG + Exonic
1178632145 21:34271187-34271209 TACCTAGGACAAGTTAAAAGAGG + Intergenic
1179940286 21:44635005-44635027 TACCCAACAGAATTAAAAAGAGG + Intronic
1182265036 22:29107893-29107915 TACCAAGGAGAGGCTTAAAGAGG - Intronic
955077875 3:55630875-55630897 AACACTGGAGAATCTAAGAGTGG + Intronic
960435951 3:117626779-117626801 TTCCCTGGAGGAACTAAAAGAGG + Intergenic
960446987 3:117761262-117761284 TAAGCAGGAGAATCTTAAAAAGG - Intergenic
960573006 3:119203913-119203935 TACCCAGGAGAACCCAAAACTGG - Exonic
960628187 3:119701964-119701986 TAACCAGGATAATCTCATAGAGG - Intergenic
960651765 3:119958913-119958935 TACTCAGGAGAAACTAGAAACGG + Intronic
961561453 3:127733257-127733279 TACCCAGTATAGTCTAAAAAGGG + Intronic
961921074 3:130427331-130427353 TAATCAGAAGAATGTAAAAGGGG + Intronic
962843983 3:139259381-139259403 GACCAAAGAGAATATAAAAGGGG + Intronic
963592172 3:147274685-147274707 AATCCAGGAGAATCTACAAGTGG + Intergenic
965818172 3:172658237-172658259 TACCCTGTATAATCTAAAAGGGG + Intronic
967279810 3:187811033-187811055 AACCCAGGAGAGCCAAAAAGTGG + Intergenic
971112179 4:23599918-23599940 TACCCAGAAGAAATAAAAAGTGG - Intergenic
972848934 4:43024468-43024490 TCCCCAGGTGAATCTATAGGTGG - Intronic
973868471 4:55139290-55139312 TACCCATCAGAATCTAACAGCGG + Intergenic
979066425 4:116141352-116141374 TTCCCAGGAGAAACTAAGGGTGG + Intergenic
979570819 4:122222311-122222333 TACCCAGGATAAACTACAAGTGG - Intronic
986227571 5:5829802-5829824 TACCCAAGAGAATTGAAAACAGG - Intergenic
989922172 5:49820213-49820235 CACCCTGTAGAATCTGAAAGTGG + Intergenic
994742557 5:103639150-103639172 TACCAACTAGAATCTAAAATAGG - Intergenic
995282960 5:110355986-110356008 TACACAGGAGGATCTAAAGCTGG - Intronic
996284435 5:121771575-121771597 TAGCCATGAGAAGATAAAAGAGG + Intergenic
996852753 5:127970790-127970812 TACCAAGAAGAAGATAAAAGTGG - Intergenic
997636113 5:135408385-135408407 TACACAGGAGAAAATAAAATAGG - Intergenic
998026834 5:138824283-138824305 TAGCCAGGAGAAAGTAGAAGTGG + Intronic
998180910 5:139940723-139940745 TACCCAAGAAAATATAACAGTGG + Intronic
999126064 5:149246955-149246977 TACCCAGAAGAATTAAAAACAGG + Intronic
999144719 5:149384841-149384863 TAGCCAGGAGATTCTAGAAGAGG + Intronic
999504820 5:152183826-152183848 TACACAGTAGAATCCACAAGGGG - Intergenic
1000109809 5:158097546-158097568 GACCCAGGAGAATCTATACAAGG - Intergenic
1003064109 6:2888339-2888361 TACCCAAGAGAATGCAAAATAGG + Exonic
1012413336 6:98985548-98985570 TACAGAGGAGAATGTAAAGGAGG - Intergenic
1013616044 6:111844397-111844419 TATCCAGAAGAATCTAATATAGG - Intronic
1014985736 6:128005589-128005611 TACCCAGGAGTATCAAAACTTGG - Intronic
1016193701 6:141303985-141304007 AACCCAGGAGAATGCAATAGGGG + Intergenic
1016513875 6:144872387-144872409 TACCCTGTATGATCTAAAAGGGG - Intergenic
1016568005 6:145479743-145479765 TACCCAGAAGAATTGAAAACAGG - Intergenic
1016633825 6:146264695-146264717 TACACTGGAGACTCCAAAAGAGG - Intronic
1019460747 7:1157163-1157185 TACACAGCAGAAACTGAAAGAGG - Intronic
1020449742 7:8307300-8307322 TAACCAGGAAAATATAATAGAGG - Intergenic
1022763620 7:33384410-33384432 TACTCAAGAGAATCTAACATAGG - Intronic
1025820036 7:64954671-64954693 TACCTAGGATAATGTAAAACAGG + Intergenic
1027030092 7:74881802-74881824 AACCCAGGAAAGTCTAAATGAGG + Intergenic
1028818154 7:95173262-95173284 TACACTGGGGACTCTAAAAGAGG + Intronic
1030160325 7:106501577-106501599 TACCGAATAGAGTCTAAAAGTGG - Intergenic
1031635000 7:124091799-124091821 TGCCCAGGATAATCTGAAGGTGG - Intergenic
1032205079 7:129856491-129856513 TACACAGTAGAAAGTAAAAGTGG + Intronic
1033176468 7:139128397-139128419 TACCCAGAAGCATGCAAAAGAGG + Intergenic
1034116292 7:148586670-148586692 TACCCTATATAATCTAAAAGGGG + Intergenic
1034903933 7:154927529-154927551 CACCCAGAAGCATCCAAAAGAGG - Intergenic
1036109222 8:5879066-5879088 TACACAGAAGAACCTAAAAAGGG - Intergenic
1038848322 8:31250460-31250482 TATCCACTTGAATCTAAAAGGGG + Intergenic
1038885776 8:31661364-31661386 TCCCCAGCAGAATCTGAAAGAGG + Intronic
1039335877 8:36588729-36588751 TAACCAGGAAAATCTAATAGAGG + Intergenic
1044077369 8:87839427-87839449 TACCCAGGAGAATTGAAAGCAGG + Intergenic
1048082551 8:131144790-131144812 GACCCAGGAGTATATAGAAGAGG + Intergenic
1050073199 9:1838092-1838114 CACCCAGCAGAAGCTAGAAGAGG - Intergenic
1050797893 9:9567946-9567968 TACCCAGTAGAAAAAAAAAGGGG - Intronic
1051753851 9:20374020-20374042 TACAGAGGAGAAACTAAATGAGG - Intronic
1055369926 9:75586606-75586628 AACCCAGTAGAAACTAATAGAGG - Intergenic
1055370811 9:75596955-75596977 TACCCAGTAGAAACAAAAATAGG + Intergenic
1057707718 9:97408804-97408826 TACCAAGGAGAGAGTAAAAGTGG + Intergenic
1058163901 9:101598917-101598939 TACTCAGGAGAATGTAAGTGAGG - Intronic
1060585911 9:124785708-124785730 TACCCAAGAGAATTGAAAATGGG - Intronic
1185535362 X:857193-857215 TACCCAGGAAAAGCAAAAACTGG + Intergenic
1185944489 X:4359569-4359591 TACCCAGAAGAATTAAAAACAGG + Intergenic
1186747834 X:12587787-12587809 TACCCAAAAGAATTTAAAACAGG - Intronic
1186839682 X:13472853-13472875 TACCCAAGAGAATGGAAAACAGG + Intergenic
1187728464 X:22228615-22228637 TAACCAGGAAAATCTAAAGATGG - Intronic
1187912618 X:24124907-24124929 TTCCCAGCACAACCTAAAAGTGG + Intergenic
1190432287 X:50389838-50389860 TAACCAGGAGAATAAGAAAGGGG - Intronic
1191023761 X:55891220-55891242 CAACCACCAGAATCTAAAAGAGG - Intergenic
1192718194 X:73665270-73665292 TACACAGAAGAGCCTAAAAGGGG - Intronic
1195000648 X:100640013-100640035 TACTGAGGAGAGTATAAAAGGGG - Intergenic
1196151002 X:112374448-112374470 TAGCCAGGAAAATATTAAAGAGG - Intergenic
1196370404 X:114972510-114972532 TACCCAAGAGAATTGAAAATAGG - Intergenic
1197940512 X:131783839-131783861 TATCCAGCAGAAGCCAAAAGTGG - Intergenic
1198788479 X:140316558-140316580 TACCCAGGAGAATAGAAAGCAGG + Intergenic
1200891651 Y:8330468-8330490 CACCAAGGAGAAATTAAAAGTGG + Intergenic
1200968010 Y:9118936-9118958 TACACAGAAGAGTCTAAAAAGGG - Intergenic