ID: 1177825919

View in Genome Browser
Species Human (GRCh38)
Location 21:26082765-26082787
Sequence CTATCAACTCTGTAAGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 109
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 103}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177825907_1177825919 18 Left 1177825907 21:26082724-26082746 CCTTAAATTCCTGAGCTGAAATC 0: 1
1: 0
2: 5
3: 100
4: 953
Right 1177825919 21:26082765-26082787 CTATCAACTCTGTAAGAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1177825912_1177825919 -9 Left 1177825912 21:26082751-26082773 CCCCTTCAGGCCCACTATCAACT 0: 1
1: 0
2: 0
3: 10
4: 156
Right 1177825919 21:26082765-26082787 CTATCAACTCTGTAAGAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1177825910_1177825919 -4 Left 1177825910 21:26082746-26082768 CCCATCCCCTTCAGGCCCACTAT 0: 1
1: 0
2: 0
3: 15
4: 120
Right 1177825919 21:26082765-26082787 CTATCAACTCTGTAAGAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1177825911_1177825919 -5 Left 1177825911 21:26082747-26082769 CCATCCCCTTCAGGCCCACTATC 0: 1
1: 0
2: 4
3: 22
4: 215
Right 1177825919 21:26082765-26082787 CTATCAACTCTGTAAGAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1177825913_1177825919 -10 Left 1177825913 21:26082752-26082774 CCCTTCAGGCCCACTATCAACTC 0: 1
1: 0
2: 0
3: 8
4: 128
Right 1177825919 21:26082765-26082787 CTATCAACTCTGTAAGAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 103
1177825908_1177825919 9 Left 1177825908 21:26082733-26082755 CCTGAGCTGAAATCCCATCCCCT 0: 1
1: 0
2: 0
3: 31
4: 245
Right 1177825919 21:26082765-26082787 CTATCAACTCTGTAAGAGGGAGG 0: 1
1: 0
2: 0
3: 5
4: 103

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177825919 Original CRISPR CTATCAACTCTGTAAGAGGG AGG Intronic
900478161 1:2885820-2885842 CTGGCATCCCTGTAAGAGGGGGG - Intergenic
905956140 1:41998105-41998127 CTTTTAACACTCTAAGAGGGTGG - Intronic
906591686 1:47030721-47030743 CTGTCAACTTTGTAAAAGGAAGG + Intronic
907178121 1:52544749-52544771 CTATCAACTGAGTAAAATGGTGG + Intronic
908651392 1:66337092-66337114 CTTAGAACTCTGTAAGAGAGAGG + Intronic
910365635 1:86461982-86462004 TTCTGAACTCTGTTAGAGGGTGG - Intergenic
910468400 1:87524598-87524620 CTATCCACTGTGTGTGAGGGAGG - Intergenic
918999779 1:191815445-191815467 CTATCAAAACTGTAAAAGGAAGG - Intergenic
921478405 1:215636318-215636340 CTTTGAACTCCGTAAGAGGAGGG + Intronic
923006659 1:230055298-230055320 CTATCCACTCTGCAGGAGGTTGG - Intergenic
1063146149 10:3296874-3296896 CTGGCAACTCTCAAAGAGGGAGG + Intergenic
1064018509 10:11791237-11791259 CTAGCACCTTTGCAAGAGGGAGG - Intergenic
1070682750 10:78460470-78460492 ACATCAATTCTGAAAGAGGGAGG - Intergenic
1072114088 10:92352187-92352209 CTGTCAACTCTGTAAGAGCTTGG - Exonic
1072212031 10:93254845-93254867 CTATCAACTATGTAGGAGAAAGG + Intergenic
1078804979 11:14689795-14689817 CTTTCAAGTCTGTAGGAGGAAGG + Intronic
1079984293 11:27184242-27184264 CTATTAACTCTGTCAAAGGAAGG - Intergenic
1087567031 11:99874048-99874070 CTGGGAACTCTGAAAGAGGGAGG + Intronic
1088928516 11:114325818-114325840 CTATCAGCTCTGCCAGAGGCAGG - Intergenic
1091965120 12:4734310-4734332 ATACCAATGCTGTAAGAGGGTGG - Intronic
1093235588 12:16605556-16605578 ATATCAACTCTTTAAGAAGTGGG + Intronic
1098685827 12:73419201-73419223 TTATCAACTCTTTGAGAGAGAGG - Intergenic
1099282694 12:80672199-80672221 CTATAAACTCTGTAAGTGCAGGG + Intronic
1099557278 12:84125833-84125855 ATATCTACTATGTAACAGGGAGG + Intergenic
1100383057 12:94079849-94079871 GAATCAACTGTGTAAGAGAGAGG + Intergenic
1114344418 14:21780659-21780681 CTACCAACTCGGTAGGAGGCAGG - Intergenic
1114491501 14:23105112-23105134 CTGGCACCTCTGGAAGAGGGTGG - Intergenic
1114847899 14:26346230-26346252 CAATCAAATCAGTAACAGGGAGG - Intergenic
1117546887 14:56800373-56800395 ATATCAAGTTTTTAAGAGGGAGG - Intergenic
1117807286 14:59507677-59507699 CTATCACCTCTCCAGGAGGGTGG + Intronic
1120248648 14:82035461-82035483 ATATGAACTCTGGAAGAGTGAGG - Intergenic
1121689555 14:95866638-95866660 CTTTCTACTCTGTAAGTGTGGGG + Intergenic
1122080070 14:99260994-99261016 CTTTCAACGCTGAAAGTGGGAGG - Intronic
1127366008 15:58291148-58291170 CTATCCATTCTGGAAAAGGGGGG + Intronic
1127623109 15:60753290-60753312 CTTTCATCTCTGTTACAGGGTGG + Intronic
1128577898 15:68788906-68788928 TTAACAACCCTGTGAGAGGGTGG - Intronic
1129696520 15:77743337-77743359 CTATGTACTCTGTAAAAGGAGGG + Intronic
1130114547 15:80995494-80995516 CTATCATCTCTGTAAGGGCAGGG - Intergenic
1134662309 16:15993358-15993380 CTCTAAACTCTGTAATAGGTGGG + Intronic
1135503464 16:23016675-23016697 CTCTCAACTCAGGAAGAAGGTGG + Intergenic
1139109443 16:63871678-63871700 CCATCTGCTCTGTGAGAGGGAGG + Intergenic
1140901618 16:79373107-79373129 TTATAAACTCTGTAAGGGGAGGG + Intergenic
1151138576 17:71970715-71970737 TTTTCAACTCTGTAGGCGGGGGG + Intergenic
1156885177 18:42127008-42127030 ATATCAACTGTGTTGGAGGGGGG + Intergenic
1157816517 18:50733261-50733283 CGCTCAACTCTGTAGGATGGAGG - Intergenic
1158294098 18:55974889-55974911 CTGTGAACTCTGTATGAGTGTGG - Intergenic
1159424354 18:68265131-68265153 CTATCACCTCTGTAAAATGAAGG - Intergenic
925245285 2:2377268-2377290 CTATCTTCTCTGCCAGAGGGTGG - Intergenic
929982041 2:46690339-46690361 CTACCTCCTCTGTAAGAAGGGGG + Intergenic
929990685 2:46783761-46783783 CTGTCAACTCTGTCAAATGGGGG - Intergenic
932375853 2:71235295-71235317 CTATCAATTCAGTGTGAGGGTGG + Intergenic
936992443 2:118380531-118380553 ATATCAACTTTGTAATAAGGTGG - Intergenic
943390037 2:187254734-187254756 CTATTAACTCTATAATAAGGAGG - Intergenic
944925475 2:204459460-204459482 CTACCAACTCTATATGAGGGAGG - Intergenic
945969842 2:216224619-216224641 TTATCAGCTCTGTCAGTGGGAGG + Intergenic
946076090 2:217074890-217074912 CTATTATTTCTGTAAGAAGGCGG - Intergenic
948014216 2:234674565-234674587 CTGTCAACTCTCTAAGCAGGAGG + Intergenic
948715412 2:239857778-239857800 ATATCAACTCTGAGAGATGGAGG + Intergenic
1173485744 20:43439727-43439749 ATCTCATCTCTGCAAGAGGGAGG - Intergenic
1176760406 21:10777994-10778016 GTTTCAACTCTGTAAGATGAAGG - Intergenic
1177825919 21:26082765-26082787 CTATCAACTCTGTAAGAGGGAGG + Intronic
1178178983 21:30137915-30137937 CTTTCAACTCTGTAAAGGGTTGG - Intergenic
1179167282 21:38944810-38944832 CCATCAACTCTGTGAGAGCGGGG + Intergenic
949208319 3:1467318-1467340 GTATCAAATATGTGAGAGGGAGG - Intergenic
951256261 3:20452932-20452954 CTTTCACCTGTGTAACAGGGAGG + Intergenic
955628377 3:60945648-60945670 GTATAAACCCTGTAATAGGGAGG - Intronic
962040641 3:131704204-131704226 CTACCAGCTCTGCAAGAGGGAGG - Intronic
963319160 3:143794156-143794178 CTAGAAACTCTGTAAGAGAATGG + Intronic
964864290 3:161238337-161238359 CTACCACCTCTGTGAGTGGGTGG - Intronic
965548056 3:169935325-169935347 CTATCCTCTCTGGAAGTGGGAGG + Intronic
966787007 3:183631097-183631119 CAAACAACTCTGAGAGAGGGAGG - Intergenic
968355919 3:198106740-198106762 CTATCAAGACTGTTAGAGGAGGG - Intergenic
970274778 4:14386518-14386540 CTATGAACTTTAGAAGAGGGAGG - Intergenic
970833859 4:20376653-20376675 CTATAAACTCTGTAAGAAGAGGG + Intronic
972895131 4:43610556-43610578 CAATCAACCCTGAAAGAGAGTGG - Intergenic
973909454 4:55564787-55564809 CTATCAATTTTATAAAAGGGTGG - Intronic
977180670 4:93869711-93869733 CTATGAACTCTGAAGGAGGCAGG + Intergenic
979770016 4:124512124-124512146 CTAGCAAATCTGGAAGAAGGTGG + Intergenic
980282162 4:130736534-130736556 CCACCAACTCAGTAAGAGGCAGG - Intergenic
981806610 4:148723330-148723352 CTATAAAGTCTGAGAGAGGGAGG - Intergenic
984845268 4:184103062-184103084 CTTTGAACTTTCTAAGAGGGAGG - Intronic
988886257 5:35561528-35561550 CCATTAACTCTGTATGAGAGTGG - Intergenic
991069346 5:62459109-62459131 ATATCAACTCAGTAAGGAGGAGG - Intronic
991945060 5:71891697-71891719 CTATTAACTCTGTAAGGGTAAGG + Intergenic
992229289 5:74647987-74648009 CTTTCAACTCTGAAAGACAGAGG + Intronic
1004022352 6:11787150-11787172 CAAACAACACTGTCAGAGGGTGG + Intronic
1007270694 6:40634907-40634929 GGATCAACTCTGGAAGAGGCAGG + Intergenic
1009253400 6:61341243-61341265 GTTTCAACTCTGTAAGATGAAGG - Intergenic
1009258086 6:61443064-61443086 GTTTCAACTCTGTAAGATGAAGG - Intergenic
1022431395 7:30325680-30325702 TTGTCAACCCTGTAATAGGGTGG - Intronic
1022884310 7:34626121-34626143 CTATGAACTCTGGAACAGAGAGG - Intergenic
1028946989 7:96591411-96591433 TTTTTAACTCTGTTAGAGGGAGG - Intronic
1030596114 7:111540807-111540829 CTATCAACATTGTAAACGGGTGG - Intronic
1033547431 7:142414065-142414087 CTAGGAACTTGGTAAGAGGGAGG + Intergenic
1037232881 8:16680955-16680977 CTTTCCACTCTGTTAGGGGGTGG - Intergenic
1037692329 8:21192645-21192667 CTATAAACTCTGTGAAAGTGGGG + Intergenic
1037922435 8:22816722-22816744 GCATCAACTCTGTAAGATAGTGG - Intronic
1039102543 8:33956661-33956683 CTATCATCTCTGAAAGAGACAGG - Intergenic
1040674743 8:49735055-49735077 CTCTCAACACAGTAAGTGGGAGG + Intergenic
1043557641 8:81451055-81451077 CTATGAATTCTGCAAGAGGCAGG + Intergenic
1044791290 8:95849696-95849718 CTGTCTACTCTTAAAGAGGGAGG + Intergenic
1045646729 8:104306700-104306722 CCATCTATTCTGTCAGAGGGAGG + Intergenic
1050888025 9:10790306-10790328 CCACCAACTCAGTAAGGGGGCGG - Intergenic
1052529501 9:29662925-29662947 TTATCAAACCTGTAAGAGTGAGG - Intergenic
1057293809 9:93824020-93824042 CCAACAACTCTGCAAGGGGGAGG - Intergenic
1186790153 X:12989465-12989487 ATACCAACTGTGTAAGAGGAGGG - Intergenic
1187307872 X:18113513-18113535 GTTTCAACTCTGTAAGTGTGAGG + Intergenic
1189038125 X:37513661-37513683 TGATCAACTCTGTTTGAGGGTGG - Intronic
1198809834 X:140524210-140524232 TTATCCACTCAGTAAGATGGTGG - Intergenic