ID: 1177830504

View in Genome Browser
Species Human (GRCh38)
Location 21:26133830-26133852
Sequence TTTCTTATATTGGTTCTGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 285
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 255}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177830504_1177830507 10 Left 1177830504 21:26133830-26133852 CCAATCAGAACCAATATAAGAAA 0: 1
1: 0
2: 1
3: 28
4: 255
Right 1177830507 21:26133863-26133885 ACCAAAATACAGATTTGATATGG 0: 1
1: 0
2: 2
3: 31
4: 356

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177830504 Original CRISPR TTTCTTATATTGGTTCTGAT TGG (reversed) Intronic
901172870 1:7275370-7275392 TTACTTATTTTGGTTTTAATTGG - Intronic
902305484 1:15535203-15535225 TTTCTTATCTTGGTTTGAATTGG + Intronic
904474176 1:30754219-30754241 TTTCTTAAATTGGGTCTCTTGGG - Intronic
906598974 1:47106979-47107001 TTTCAAATATTGGATTTGATTGG + Intronic
907420005 1:54340863-54340885 TTTCTTGGATTGGCTCTGGTGGG - Intronic
907690205 1:56657050-56657072 TTTCTTACATTTATTCTGCTGGG - Intronic
909650473 1:77970731-77970753 TTTCTTAAATTGGTTCAGTCAGG - Intronic
909688842 1:78382092-78382114 TTTCTTATATTGTATGTGGTGGG + Intronic
909993891 1:82255341-82255363 TATCTCATAGTGGTTTTGATTGG - Intergenic
910265556 1:85333335-85333357 TTTTTTAGATTGGTTTTCATAGG - Intronic
911610998 1:99959038-99959060 TTTCTTTTATTGGCTCTGTAGGG - Intergenic
912065728 1:105739405-105739427 TTTCTTTTATTGGTAGTTATGGG + Intergenic
913030945 1:114902129-114902151 TTTCTTTTTTTGGTACAGATGGG - Intronic
916689744 1:167178877-167178899 TTTCTTTTTTTCGTTCTTATTGG + Intergenic
916898197 1:169189627-169189649 TTTCTTATATTATTTCTGATTGG + Intronic
917708778 1:177662356-177662378 TTTCTTATATTGTTTTTATTTGG - Intergenic
918950348 1:191127820-191127842 CTTCTTATATTGTTTCTCACAGG - Intergenic
920044923 1:203126984-203127006 ATTCTTATTTTGGTCCTGTTAGG + Intronic
921191673 1:212714532-212714554 TTTATTTTATTCATTCTGATAGG + Intergenic
921328516 1:214012060-214012082 TTTCATATTTAGGTTCTGAGAGG + Intronic
923273070 1:232374697-232374719 TTTCCTATCTCAGTTCTGATCGG + Intergenic
924186317 1:241495081-241495103 TTTCTTTTAATGGTTCAGTTTGG - Intergenic
1062868120 10:874610-874632 TTTCTTATTATGGTTCTGACAGG + Intronic
1064105476 10:12497504-12497526 TTTCTTTTTATGGTTGTGATGGG + Intronic
1064490970 10:15856811-15856833 ATTCTTATTTTGGTTCTGTTTGG + Intronic
1065346295 10:24750961-24750983 TTTCTTGTAGTCATTCTGATAGG + Intergenic
1067690704 10:48499737-48499759 ATTCTTTTATTGATTATGATGGG - Intronic
1070268432 10:74927462-74927484 TTTTTTTTTTTGGTTCTGACAGG + Intronic
1070959510 10:80488749-80488771 TTTCTTCTGTTGGCTCTGGTGGG + Intronic
1074143646 10:110698212-110698234 TTTCTTATATTAGTTATCACAGG + Intronic
1074287915 10:112115835-112115857 CTTCTTTTATTGTTTTTGATAGG - Intergenic
1075322147 10:121499946-121499968 TTTCTTTTGTGGGTTCTCATGGG - Intronic
1077947547 11:6917998-6918020 TTTCTTATATTGGTAATGTAGGG + Intergenic
1079690590 11:23412183-23412205 GTTATTATAATGCTTCTGATTGG - Intergenic
1080085049 11:28269866-28269888 TATTTTAAATTGGATCTGATGGG + Intronic
1080117465 11:28636855-28636877 TTTTTTATATTGGTTATGCAAGG + Intergenic
1080293246 11:30695464-30695486 TTGCTTATGTTGCTTATGATGGG - Intergenic
1081503639 11:43692044-43692066 TTTCTTGTATTCATTCTGGTGGG + Intronic
1081778055 11:45690274-45690296 TATTTTATATTTGTTTTGATTGG - Intergenic
1084293187 11:68190152-68190174 TTTCATATTTTGTTTCTGTTAGG - Exonic
1086031443 11:82361936-82361958 TTTCTTATAATGGGTTTGTTAGG + Intergenic
1086751406 11:90498823-90498845 CTTCTCATATCTGTTCTGATAGG + Intergenic
1087459719 11:98430575-98430597 TTACTTTTATTTGTTGTGATTGG + Intergenic
1088838897 11:113605550-113605572 TTTCTAATTATGTTTCTGATTGG + Intergenic
1088989973 11:114944821-114944843 TGTCTTTTATTGCTTCTGTTTGG + Intergenic
1090129140 11:124121288-124121310 TTTATAATATTGGTTATTATGGG + Intronic
1090350017 11:126101855-126101877 TATGTTATATGGGTTCTGAGAGG - Intergenic
1091087721 11:132739084-132739106 TTTGTTATATAGATTCTGCTTGG - Intronic
1091673741 12:2472092-2472114 TTCATTATATTTGTTCTGCTTGG + Intronic
1091929237 12:4381701-4381723 TTTCTTATTCTGGTTGTGAAAGG + Intergenic
1092912911 12:13164162-13164184 TTTTTTTTTTTGGTTCTCATAGG - Intergenic
1093233225 12:16574503-16574525 TTTCTTATAGTCTTTCTGACAGG + Intronic
1093447621 12:19278707-19278729 TTTCCTATTTTGTTTCTGCTTGG - Intronic
1095156532 12:38863091-38863113 TTTCTTTTTTTGGTTCTTCTTGG - Intronic
1095313510 12:40729420-40729442 TTTATTGCATTGGTTATGATGGG + Intronic
1096366892 12:51035732-51035754 TTTCTAATATTGATTCAGCTAGG + Intergenic
1096420785 12:51455628-51455650 TCTCTTGAATTGGTTCTGTTTGG + Intronic
1096588322 12:52639702-52639724 TGTCTTTTTTTGGTTCTTATTGG - Intergenic
1097956354 12:65489775-65489797 TCTCTTATTGTGGTTTTGATTGG - Intergenic
1098872439 12:75832212-75832234 TTTCTTCTATTGTTTGTGACAGG - Intergenic
1099991501 12:89727027-89727049 TATCTCATTTTGGTTTTGATTGG - Intergenic
1100411561 12:94324116-94324138 TTTCTTATATTGATTCTATCAGG + Intronic
1101027963 12:100632314-100632336 TTTCCCATATTGCTTCAGATTGG + Intergenic
1103484752 12:121274985-121275007 TTTCTTATACTTGTTCCTATAGG - Intronic
1104516890 12:129435527-129435549 TTTCTCATGGTGGTTTTGATTGG + Intronic
1106053942 13:26221326-26221348 TCTCTTTTATTGCTTCAGATGGG - Exonic
1106831367 13:33586828-33586850 ATTCTGACATTGGTTCTCATGGG + Intergenic
1107584753 13:41832807-41832829 TTTCTTATTTTGGTTTAGTTGGG - Intronic
1109185418 13:59262222-59262244 GTTGTTACAGTGGTTCTGATAGG + Intergenic
1109893216 13:68646309-68646331 TTTCTTTTATTGGTCCTGAAAGG - Intergenic
1111153168 13:84285609-84285631 TTTATTATATTACTACTGATGGG + Intergenic
1111456463 13:88490989-88491011 TATCAGATATTAGTTCTGATTGG - Intergenic
1111661549 13:91218817-91218839 TTTTTAATATTGGTTTTCATTGG + Intergenic
1113648841 13:112019221-112019243 CTTCTTAAATTGGTTCTGTCAGG + Intergenic
1114381972 14:22215689-22215711 TTTCTTAGCTTGGTTGTTATTGG + Intergenic
1114824348 14:26058807-26058829 TGTCTTATAGTAGTCCTGATAGG + Intergenic
1115348505 14:32368007-32368029 TTTCTTCTATTGGTCCTGCCAGG + Intronic
1116117485 14:40674415-40674437 TTTTTTCTATTTCTTCTGATGGG - Intergenic
1116754671 14:48931937-48931959 GTTCTCATGTTGGTTCTTATTGG - Intergenic
1117639253 14:57780007-57780029 TGTCTTATATTGGTTTTCAAGGG - Intronic
1117762536 14:59045888-59045910 ATTCATTTATTAGTTCTGATAGG + Intergenic
1117883941 14:60339791-60339813 CTTCTTATATTGGTATTGAATGG + Intergenic
1125099395 15:35893088-35893110 TTTCTTACTTTGTTTCTTATTGG + Intergenic
1125753524 15:42046584-42046606 TTTCTGATATTGGTGCTATTAGG - Intronic
1126515294 15:49527433-49527455 TGTCTTATTTTGGTTCTCATGGG - Intronic
1127055485 15:55126832-55126854 TCTGTTATATTTTTTCTGATAGG - Intergenic
1127141876 15:55986530-55986552 TTTCTCATTTTGGGTCTGTTTGG - Intronic
1128579405 15:68798323-68798345 TTTCTTAGATGGGTTATGCTGGG - Intronic
1130213109 15:81944456-81944478 TTTCTTGTATTTCTTCTTATTGG + Intergenic
1132297038 15:100746196-100746218 TTTCTTATCTTTCTTTTGATGGG + Intergenic
1132474466 16:126871-126893 TATCTTAAATTGTTTCTGAGAGG + Intronic
1133909845 16:10055777-10055799 TTGCTTTTATTGTTTCAGATTGG - Intronic
1143206572 17:5144597-5144619 TTTCTTACAATGGCTCTGATTGG + Intronic
1144532682 17:16054957-16054979 TGTCTCATTTTGGTTTTGATTGG - Intronic
1145088564 17:19966170-19966192 TTTCCTGTTTTGGTTCTGTTAGG + Intronic
1145846610 17:28043366-28043388 TTTCTTCTGTTGGTTGTCATTGG + Intronic
1146260887 17:31419860-31419882 TTTCTTATATTGCTTTTGTTTGG + Intronic
1149300224 17:55298317-55298339 CTTCTTATATAGGTCCTGGTGGG + Intronic
1149553452 17:57556824-57556846 TTTCTTTTATTAGTACTGTTGGG - Intronic
1149873827 17:60209614-60209636 TTTCTTACAATGGCTCTGATTGG - Intronic
1150087607 17:62286874-62286896 TTTCTTACAATGGCTCTGATTGG - Intergenic
1150511793 17:65760709-65760731 TTTCTTATAATGCTTCTGTCTGG + Intronic
1150619895 17:66800153-66800175 TTTCTTAAATTGGTTCACTTCGG - Intronic
1151039735 17:70844640-70844662 TTCCATATTTTAGTTCTGATTGG - Intergenic
1154985275 18:21545104-21545126 TTTCTTTTTTTGGTTCAGATGGG + Intronic
1155040386 18:22060422-22060444 TTTCTTATCTCGGCTCTGTTTGG - Intergenic
1155722219 18:29029950-29029972 TTTTTTTTTTTGGTACTGATGGG - Intergenic
1155945060 18:31838962-31838984 TTACTTAGATTGTTTCTAATAGG + Intronic
1156988970 18:43383105-43383127 TTACTTTTATTGCTACTGATGGG - Intergenic
1160032115 18:75271178-75271200 TTTCTCCTATTTCTTCTGATCGG - Intronic
1163971496 19:20800374-20800396 TGTATTATCTTGGTTTTGATGGG + Intronic
1165647867 19:37458694-37458716 TTTCTTATATAGGTTGTGCTGGG - Intronic
1167222462 19:48210315-48210337 TCTTTTAGAGTGGTTCTGATAGG - Exonic
1167675443 19:50881711-50881733 TTTCTAAGATTGATACTGATAGG - Intergenic
1168520110 19:57043471-57043493 TTTCTTATCTTGGTTCTGGAAGG + Intergenic
926808260 2:16733286-16733308 TTTAATAAATTGGTTCTGTTTGG - Intergenic
928556222 2:32428017-32428039 TTTCTTATTTTGTTTCTTTTGGG + Intronic
928647013 2:33365325-33365347 TTTCTTCTATTTGTTCTGAAAGG - Exonic
928701242 2:33901222-33901244 TTTCTTGTGTGGTTTCTGATGGG + Intergenic
931598014 2:63971471-63971493 TTTAATATATTGGTTCTACTGGG - Intronic
931977560 2:67659591-67659613 TTACTTACATTGTTTCTAATAGG + Intergenic
933313056 2:80684581-80684603 TGTCTTATATTGGTTCAAAATGG + Intergenic
933518550 2:83338731-83338753 TATCTTATTGTGGTTTTGATTGG - Intergenic
933857520 2:86430188-86430210 TTTATTATTTTTGGTCTGATGGG - Intergenic
934858623 2:97744956-97744978 TTTCTTTTATTGCTTGTGCTTGG - Intergenic
934866490 2:97818186-97818208 TTTCATATATTGGCTTTTATAGG - Intronic
936171089 2:110175681-110175703 TTCTTTATATTGATTCTGTTTGG + Intronic
937435619 2:121878491-121878513 TTTTTTATATTTGTCCTGTTTGG + Intergenic
937610794 2:123858398-123858420 TGTTTTCTATTGGTTCTCATTGG - Intergenic
937840933 2:126523945-126523967 TTTCTTTTTTTGGTCCAGATGGG - Intergenic
940118889 2:150240535-150240557 TTTATTATTTTGGTTGAGATAGG + Intergenic
942528037 2:176876602-176876624 TTTCTTAAAGTGTTTCTAATAGG + Intergenic
943499031 2:188663622-188663644 TTTCGTATTTTTGTTCTGCTGGG + Intergenic
944422103 2:199542360-199542382 TCTCATATATTCATTCTGATGGG - Intergenic
1170065715 20:12307902-12307924 ATTTTTAAATTAGTTCTGATAGG + Intergenic
1173407642 20:42780395-42780417 TTTCTTGGGTTGCTTCTGATGGG - Intronic
1174702972 20:52627722-52627744 TTTCTGTCATTGGTTCTGTTTGG + Intergenic
1177830504 21:26133830-26133852 TTTCTTATATTGGTTCTGATTGG - Intronic
1178362582 21:31961570-31961592 TTTATTTTAGTTGTTCTGATAGG + Intronic
1178823417 21:35995207-35995229 TCTCTTCTATTGTTTCTGGTTGG - Intronic
1180657847 22:17438872-17438894 TTTCTTATATTAATACTGTTTGG + Intronic
1181428541 22:22860716-22860738 TTGCTTGTATTGTTTCTAATGGG - Intronic
1182217070 22:28727757-28727779 TTTCTTATATTGGGTTAGCTTGG - Intronic
1182450304 22:30416121-30416143 TTTCATCTATAGGTCCTGATAGG + Intronic
1182599231 22:31447275-31447297 TTTCTTCTATTGATTTGGATTGG + Intronic
950803570 3:15576878-15576900 TTTGTTAAATTGGGTCTCATAGG - Intronic
952036389 3:29206992-29207014 TTACTGATGTTTGTTCTGATGGG + Intergenic
952351205 3:32540257-32540279 TTTTTTAAAGAGGTTCTGATAGG - Intronic
955776690 3:62441038-62441060 TTTCTTTTAATTGTTTTGATTGG - Intronic
956272108 3:67458946-67458968 TTTGTTATATTGGGTCTCAAAGG - Intronic
957748816 3:84384097-84384119 TTTGTCATATTGTTTCTAATGGG + Intergenic
958763924 3:98342160-98342182 TTTCTTGTATTGTTTCTGTCTGG + Intergenic
960579638 3:119265333-119265355 TTTCTTATAATGTTTTTGACTGG - Intergenic
960768381 3:121164278-121164300 TTTCTCATAGTGGTTTTGATTGG - Intronic
961030166 3:123595842-123595864 TTTCTAATATTCCTTGTGATAGG - Intergenic
962188096 3:133281301-133281323 TTTCTAAATTTGGTTTTGATGGG + Intronic
962453736 3:135545915-135545937 TTCCTTATATGGTTTCTGACAGG + Intergenic
962718154 3:138146270-138146292 TTTTTTGTATAGTTTCTGATGGG - Intergenic
963291127 3:143490637-143490659 ATTCTTAAAATGGTTATGATGGG + Intronic
965094690 3:164209834-164209856 TTGCTTATATTGGATGTGACAGG - Intergenic
965217806 3:165886250-165886272 TTGCGTATATTGTCTCTGATTGG - Intergenic
966466943 3:180239915-180239937 TTTCTTATAATGCTTCTTGTTGG - Intergenic
966601434 3:181779166-181779188 TTTATTGTATTGGTTGTGATGGG - Intergenic
971279165 4:25227122-25227144 TTTCTTCACTTGGTTCTTATGGG - Intronic
972069138 4:34993353-34993375 TTTCTTTCAGTGGTTGTGATAGG + Intergenic
972368916 4:38402870-38402892 TTTCTCATTGTTGTTCTGATTGG + Intergenic
974007595 4:56574246-56574268 TTTTTTATATTTGTACGGATGGG - Intronic
974454311 4:62106328-62106350 TATCTTATTGTGGTTTTGATTGG + Intergenic
974797806 4:66776331-66776353 TTTCTTATATTAGTTTTGGCAGG - Intergenic
977286003 4:95107772-95107794 GTTCTGACATTGGTTCTGAAAGG + Intronic
978719229 4:111887351-111887373 TTTCATATATTTATTCTAATAGG + Intergenic
978791076 4:112664112-112664134 TTTCCTTTATTGGTTCTTAATGG - Intergenic
978963606 4:114714401-114714423 TTTCCTCTATTGGCTCTGAGGGG + Intergenic
979183824 4:117762445-117762467 TTTCTTAAATAGGTTATCATAGG - Intergenic
982506662 4:156227173-156227195 TTTATTAAATTGGTTATGCTTGG - Intergenic
982641791 4:157970948-157970970 ATACATATATTGGTTCTGATAGG - Intergenic
982988772 4:162244315-162244337 TTGCTTAGAGTGATTCTGATTGG + Intergenic
983104670 4:163671649-163671671 TTTCTTATATGTGTTTTCATTGG + Intronic
983352379 4:166607595-166607617 TTTCATATAATGGTTTTGTTAGG - Intergenic
983465546 4:168083640-168083662 TTTCTTATGTTGTTTCTTGTAGG - Intergenic
983614065 4:169681462-169681484 TTTATTATATTGTTTATGAAAGG + Intronic
983822726 4:172216541-172216563 TTTTTTGTATTTGTTCTGATTGG + Intronic
985751179 5:1676800-1676822 TGTCTTACATTGTTTTTGATGGG - Intergenic
986879456 5:12152839-12152861 TTTCCTATATTGTTTTTGAGGGG + Intergenic
986960722 5:13208350-13208372 TTTCTTTTATTGGATTTTATAGG - Intergenic
987162317 5:15157030-15157052 TTTATTATCTTGGTTTTCATGGG + Intergenic
987913003 5:24173809-24173831 TTTCTTATATAACTTCTTATAGG + Intronic
988371630 5:30376920-30376942 TTTCTTAGAATGCTTCTTATTGG - Intergenic
988863479 5:35308778-35308800 TTTCCTATATTGGCTTTGGTGGG + Intergenic
990031484 5:51264695-51264717 TTTCTTTTTTTAGTTCTAATGGG + Intergenic
990218847 5:53564429-53564451 TTTCTAATATGTTTTCTGATAGG + Intronic
990568870 5:57057415-57057437 TTTCTTATACTGTTTCTGTTAGG + Intergenic
990708103 5:58552978-58553000 TATCTCATAGTGGTTTTGATTGG + Intronic
991066872 5:62433406-62433428 GTTCGTATATTGGTTCTGTGTGG + Intronic
992071909 5:73156122-73156144 TTTATTATATTTGTTATTATTGG - Intergenic
992823600 5:80524611-80524633 GTTCTTATATTGTTTGAGATAGG + Intronic
993673265 5:90787385-90787407 TTATTTATATAGGTTTTGATTGG + Intronic
993915461 5:93739739-93739761 TCTCTTATAATGGTTTTGAGAGG - Intronic
994412476 5:99424916-99424938 TTTCTTTTATTTATTCTTATTGG + Intergenic
994481344 5:100340339-100340361 TTTCTTTTATTTATTCTTATTGG - Intergenic
995048493 5:107674409-107674431 TTTCTTATAGTGGCTCTAATAGG + Intergenic
997516668 5:134494830-134494852 TATCTGATATTCGCTCTGATTGG - Intergenic
998323440 5:141255479-141255501 TTTCATATTTTGTTTCTCATGGG + Intergenic
998678878 5:144442299-144442321 TTTCTCTTATTGCTTCTGAGTGG + Intronic
998866043 5:146503913-146503935 TTTCTTTTGTTTGTTCTGAACGG - Exonic
999486000 5:151996923-151996945 TCTTTTATATTTGATCTGATTGG + Intergenic
1001355221 5:171015140-171015162 TTTCTTATATTTCTTGTGCTTGG + Intronic
1003151420 6:3554152-3554174 TTTCTTATTTTAGTTCTATTTGG + Intergenic
1005573132 6:27166287-27166309 TTTCTTCTATTGGTACAGAAGGG - Intergenic
1006107757 6:31727052-31727074 TCTATTTTATTGGTTCTGAGAGG + Exonic
1008110791 6:47491878-47491900 TTGCTTAACTTGGTTCTGTTTGG - Intronic
1008272911 6:49510721-49510743 TTTCTAATATTGGTCCAGACTGG + Intronic
1008451023 6:51650990-51651012 TTCCTTAAATTCTTTCTGATAGG + Intronic
1010382911 6:75244876-75244898 TTCCTTAGATTGGTACTGAAAGG + Intronic
1010660531 6:78565809-78565831 TTTCTTCTATTTATTCTGTTTGG + Intergenic
1011065995 6:83326663-83326685 TATCTCATTGTGGTTCTGATTGG - Intronic
1012319023 6:97819512-97819534 ATAGATATATTGGTTCTGATAGG + Intergenic
1012336389 6:98063849-98063871 TATCTTATTGTGGTTTTGATTGG - Intergenic
1013855150 6:114563556-114563578 TTTCTGATATTCCTTCTGTTAGG + Intergenic
1014776529 6:125517235-125517257 TTAGTTATGTTGATTCTGATTGG + Intergenic
1014910812 6:127090737-127090759 CTTTTTAAATTTGTTCTGATAGG - Intergenic
1015668212 6:135656017-135656039 TATCTTATTGTGGTTTTGATAGG + Intergenic
1015763249 6:136687701-136687723 TATCTCATTTTGGTTTTGATTGG - Intronic
1015834630 6:137406876-137406898 TTTCTCATTGTGGTTTTGATTGG + Intergenic
1017427292 6:154335478-154335500 TTTCTTATATTGATACTGTATGG - Intronic
1018303162 6:162425080-162425102 TTTCTTCTACCTGTTCTGATGGG - Intronic
1018467214 6:164059299-164059321 TTGCCTATTTTGCTTCTGATAGG + Intergenic
1019849248 7:3538041-3538063 TTTCTTATTTTGGCTCTCCTGGG + Intronic
1020218483 7:6214918-6214940 TTTCTTATCTTGATTTTGATTGG + Intronic
1021091525 7:16488081-16488103 TTTTTTATATTGGTTTTTATTGG + Intronic
1021519964 7:21529206-21529228 TTTCTTTTATTAGTACAGATGGG - Intergenic
1021794837 7:24243692-24243714 TTTCCTATATAGGTAATGATAGG + Intergenic
1022081180 7:27023550-27023572 TTATAAATATTGGTTCTGATTGG - Intergenic
1022313842 7:29225439-29225461 TTTCATATATTGGTTTTGGTGGG - Intronic
1023380472 7:39602161-39602183 TTTCTTATGTTCTTTCTGACTGG - Intronic
1025761913 7:64403550-64403572 CTTCTGATATTGTTTGTGATAGG + Intergenic
1026675855 7:72427286-72427308 TTTCTTCTTTTGGTTCTCAAAGG - Intronic
1028626532 7:92883570-92883592 TTTGTAATTTTGGTTGTGATGGG - Intergenic
1030814032 7:114012221-114012243 CTTCTCATAATGGATCTGATGGG - Intronic
1030924966 7:115440613-115440635 TTTCTCATGTTGTTTCTAATTGG + Intergenic
1033530104 7:142253483-142253505 TTTCTCATTTTGTTTCAGATTGG - Intronic
1034686074 7:152972549-152972571 TGTCTTATGTTGGTACTGATAGG + Intergenic
1036743243 8:11385759-11385781 TTTATTTTAGTGATTCTGATAGG - Intergenic
1038361983 8:26889157-26889179 TTTCTGATATTGCTGCTGAGAGG + Intergenic
1038723987 8:30062717-30062739 TGTTTTAAATTGGTTCTTATTGG + Intergenic
1038896464 8:31788515-31788537 TTTCTTACAATGGTCCTGAGGGG - Intronic
1040076716 8:43243974-43243996 CCTCTTTTATTAGTTCTGATGGG + Intergenic
1040836853 8:51741557-51741579 TTTCTTAGATTGATTCTTCTCGG - Intronic
1041837700 8:62235135-62235157 GATTTTATATTGGTTATGATAGG - Intergenic
1043228687 8:77769782-77769804 TTTCTTATTTATCTTCTGATAGG - Intergenic
1043952134 8:86321123-86321145 ATTCTTATAGGGGGTCTGATGGG - Intronic
1044061645 8:87644650-87644672 TTTCTTATACTGTTTCTGTCTGG + Intergenic
1044539892 8:93396777-93396799 TTTCTTTTATTGCTTTTGGTCGG - Intergenic
1044544115 8:93440661-93440683 TTTCTTATAATAGTTTTGACAGG - Intergenic
1044859688 8:96510778-96510800 TTTATTATTTTGGTGATGATGGG + Intronic
1045019357 8:98028189-98028211 TTTGTTAAATTGTTTCTGATGGG + Intronic
1045718779 8:105081013-105081035 TATTTTATTGTGGTTCTGATTGG - Intronic
1051967058 9:22841860-22841882 TTTCTTATATTTGTGCTTAGTGG + Intergenic
1052669435 9:31536970-31536992 TTTCTTTTATTGGCTCGAATGGG - Intergenic
1052758173 9:32563340-32563362 TTTCTTTTTTTGATTCAGATGGG + Intronic
1052981251 9:34451334-34451356 TTTCTTAAATAGGCTCTGATGGG - Intronic
1055558697 9:77501380-77501402 TTTCTTTTAATCATTCTGATAGG + Intronic
1055799451 9:80017948-80017970 TTTCTTTTATTGGTTCTAAGGGG + Intergenic
1056457688 9:86778156-86778178 TTTCTCATTTTCGTACTGATCGG + Intergenic
1057932800 9:99211176-99211198 TTTTTTGGATTGGTTTTGATAGG + Intergenic
1058093698 9:100835258-100835280 TTTTTTATATTGATTATTATAGG - Intergenic
1058479234 9:105373867-105373889 TTGCTTTCATTGGCTCTGATTGG + Intronic
1059184916 9:112259342-112259364 TTTCTTATATTGGGTAAGATGGG - Intronic
1060095794 9:120788638-120788660 TGTTTTATAATGGTTTTGATGGG - Intronic
1203356251 Un_KI270442v1:149972-149994 TTTCTCATATTGCTTCTGTCTGG + Intergenic
1187573306 X:20528092-20528114 TTTCCTATATTGTTTGGGATGGG + Intergenic
1188388829 X:29594552-29594574 TTTTTTATTATGGTTCTGAATGG - Intronic
1188910525 X:35841415-35841437 TTTCATATATGGGTTCTGTGGGG - Intergenic
1190842928 X:54162951-54162973 TGTCTCATTTTGGTTTTGATGGG - Intronic
1191744040 X:64466093-64466115 TTTCTTAAATTGGTTTGGACAGG + Intergenic
1192373568 X:70535964-70535986 TTTCTTATACAGCTTCTGAGTGG + Intronic
1193173392 X:78362979-78363001 TATCTTATTGTGGTTTTGATTGG - Intergenic
1193444894 X:81589444-81589466 TTTCTTCTATATGTTCTGCTAGG - Intergenic
1193451889 X:81680920-81680942 TTTCTTCATTTGTTTCTGATAGG + Intergenic
1193764284 X:85507231-85507253 GTTCTTATATGATTTCTGATTGG + Intergenic
1195536114 X:106011276-106011298 TTTCTTAGATTTGTTTTGACTGG + Intergenic
1196584608 X:117415546-117415568 TTTCATATATTGGTTCTCCTGGG - Intergenic
1196850376 X:119932201-119932223 TTTCTTATATTTCTTCCTATAGG + Exonic
1197360597 X:125497928-125497950 TTTATTCAATTGGTTCTGATAGG - Intergenic
1199099897 X:143787377-143787399 TTTTTTATCTTGTTTCTGCTAGG + Intergenic