ID: 1177831370

View in Genome Browser
Species Human (GRCh38)
Location 21:26142674-26142696
Sequence TGGCAGCATCGCTTGAGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 111881
Summary {0: 1, 1: 92, 2: 4318, 3: 31897, 4: 75573}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1177831362_1177831370 22 Left 1177831362 21:26142629-26142651 CCTGGTGGTGCAAACCTGTAGTC 0: 3
1: 75
2: 417
3: 1333
4: 3748
Right 1177831370 21:26142674-26142696 TGGCAGCATCGCTTGAGCCCAGG 0: 1
1: 92
2: 4318
3: 31897
4: 75573
1177831368_1177831370 -1 Left 1177831368 21:26142652-26142674 CCAGCTACTCAGGAGGCTGAGGT 0: 12610
1: 113153
2: 218440
3: 237917
4: 144947
Right 1177831370 21:26142674-26142696 TGGCAGCATCGCTTGAGCCCAGG 0: 1
1: 92
2: 4318
3: 31897
4: 75573
1177831364_1177831370 8 Left 1177831364 21:26142643-26142665 CCTGTAGTCCCAGCTACTCAGGA 0: 40895
1: 157395
2: 217955
3: 208005
4: 130380
Right 1177831370 21:26142674-26142696 TGGCAGCATCGCTTGAGCCCAGG 0: 1
1: 92
2: 4318
3: 31897
4: 75573
1177831366_1177831370 0 Left 1177831366 21:26142651-26142673 CCCAGCTACTCAGGAGGCTGAGG 0: 96881
1: 202886
2: 238913
3: 154169
4: 85070
Right 1177831370 21:26142674-26142696 TGGCAGCATCGCTTGAGCCCAGG 0: 1
1: 92
2: 4318
3: 31897
4: 75573

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1177831370 Original CRISPR TGGCAGCATCGCTTGAGCCC AGG Intronic
Too many off-targets to display for this crispr